EMAIL THIS PAGE TO A FRIEND

ZNF232

zinc finger protein 232

Synonyms: ZSCAN11
Species: Human ZNF232(7775), sheep ZNF232(101115048), domestic guinea pig Znf232(100718658), naked mole-rat Znf232(101725329)
UniProtKB ID: Q9UNY5
Gene ID:
sheep(101115048) zinc finger protein 232
domestic guinea pig(100718658) zinc finger protein 232
naked mole-rat(101725329) zinc finger protein 232
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014519 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014519 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014519 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131951 MISSION® esiRNA esiRNA human ZNF232 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014519 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014519 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183090 predicted 1434
2 SASI_Hs01_00183091 predicted 1548
3 SASI_Hs02_00345802 predicted 820
4 SASI_Hs01_00183092 predicted 1589
5 SASI_Hs01_00183093 predicted 1396
6 SASI_Hs01_00183094 predicted 1682
7 SASI_Hs02_00345803 predicted 1112
8 SASI_Hs01_00183095 predicted 1269
9 SASI_Hs01_00183097 predicted 1355
10 SASI_Hs01_00183098 predicted 1598
11 SASI_Hs01_00183096 predicted 1397
12 SASI_Hs01_00183099 predicted 1682
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014519
VALIDATED
ZNF232 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 232
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014519.2-733s21c1
Sequence:CCGGTAGGATGGCTGTATCACTAACCTCGAGGTTAGTGATACAGCCATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014519.2-1838s21c1
Sequence:CCGGGCCTTTAGTCAAAGCTCATATCTCGAGATATGAGCTTTGACTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014519.2-1930s21c1
Sequence:CCGGATGGTGCTCAGAGCTCATTAGCTCGAGCTAATGAGCTCTGAGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014519.2-1272s21c1
Sequence:CCGGCAAAGAGTGAACAGGTATATTCTCGAGAATATACCTGTTCACTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014519.2-1403s21c1
Sequence:CCGGGCTACTGACACCTCTACATTTCTCGAGAAATGTAGAGGTGTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_014519.2-865s1c1
Sequence:CCGGCCACTCTACCAGTCAAGAGATCTCGAGATCTCTTGACTGGTAGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014519.2-799s1c1
Sequence:CCGGGATGATGATGATGGGACCAAACTCGAGTTTGGTCCCATCATCATCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_014519.2-1330s1c1
Sequence:CCGGGCCCAAGGACAAAGGATCATTCTCGAGAATGATCCTTTGTCCTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_014519.2-1516s1c1
Sequence:CCGGGCAGATGGTTGTCATCCATAACTCGAGTTATGGATGACAACCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_014519.2-1358s1c1
Sequence:CCGGCCACCCATTACTGAAGTGGAACTCGAGTTCCACTTCAGTAATGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014519
VALIDATED
ZNF232 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 232
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014519.2-733s21c1
Sequence:CCGGTAGGATGGCTGTATCACTAACCTCGAGGTTAGTGATACAGCCATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014519.2-1838s21c1
Sequence:CCGGGCCTTTAGTCAAAGCTCATATCTCGAGATATGAGCTTTGACTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014519.2-1930s21c1
Sequence:CCGGATGGTGCTCAGAGCTCATTAGCTCGAGCTAATGAGCTCTGAGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014519.2-1272s21c1
Sequence:CCGGCAAAGAGTGAACAGGTATATTCTCGAGAATATACCTGTTCACTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014519.2-1403s21c1
Sequence:CCGGGCTACTGACACCTCTACATTTCTCGAGAAATGTAGAGGTGTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_014519.2-865s1c1
Sequence:CCGGCCACTCTACCAGTCAAGAGATCTCGAGATCTCTTGACTGGTAGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014519.2-799s1c1
Sequence:CCGGGATGATGATGATGGGACCAAACTCGAGTTTGGTCCCATCATCATCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_014519.2-1330s1c1
Sequence:CCGGGCCCAAGGACAAAGGATCATTCTCGAGAATGATCCTTTGTCCTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_014519.2-1516s1c1
Sequence:CCGGGCAGATGGTTGTCATCCATAACTCGAGTTATGGATGACAACCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_014519.2-1358s1c1
Sequence:CCGGCCACCCATTACTGAAGTGGAACTCGAGTTCCACTTCAGTAATGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014519
VALIDATED
ZNF232 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 232
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014519.2-733s21c1
Sequence:CCGGTAGGATGGCTGTATCACTAACCTCGAGGTTAGTGATACAGCCATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014519.2-1838s21c1
Sequence:CCGGGCCTTTAGTCAAAGCTCATATCTCGAGATATGAGCTTTGACTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014519.2-1930s21c1
Sequence:CCGGATGGTGCTCAGAGCTCATTAGCTCGAGCTAATGAGCTCTGAGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014519.2-1272s21c1
Sequence:CCGGCAAAGAGTGAACAGGTATATTCTCGAGAATATACCTGTTCACTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014519.2-1403s21c1
Sequence:CCGGGCTACTGACACCTCTACATTTCTCGAGAAATGTAGAGGTGTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_014519.2-865s1c1
Sequence:CCGGCCACTCTACCAGTCAAGAGATCTCGAGATCTCTTGACTGGTAGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014519.2-799s1c1
Sequence:CCGGGATGATGATGATGGGACCAAACTCGAGTTTGGTCCCATCATCATCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_014519.2-1330s1c1
Sequence:CCGGGCCCAAGGACAAAGGATCATTCTCGAGAATGATCCTTTGTCCTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_014519.2-1516s1c1
Sequence:CCGGGCAGATGGTTGTCATCCATAACTCGAGTTATGGATGACAACCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_014519.2-1358s1c1
Sequence:CCGGCCACCCATTACTGAAGTGGAACTCGAGTTCCACTTCAGTAATGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks