EMAIL THIS PAGE TO A FRIEND

ZNF233

zinc finger protein 233

UniProtKB ID: A6NK53, B2RN78, B2RN79, Q86WL8
Gene ID:
cow(100141003) zinc finger protein 233
dog(100687959) zinc finger protein 233
domestic cat(101098504) zinc finger protein 233
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181756 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181756 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181756 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123131 MISSION® esiRNA esiRNA human ZNF233 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181756 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092017 predicted 751
2 SASI_Hs01_00092018 predicted 2085
3 SASI_Hs01_00092019 predicted 468
4 SASI_Hs01_00092020 predicted 290
5 SASI_Hs01_00092021 predicted 1979
6 SASI_Hs02_00370360 predicted 957
7 SASI_Hs01_00092023 predicted 1281
8 SASI_Hs02_00370361 predicted 1562
9 SASI_Hs01_00092024 predicted 978
10 SASI_Hs01_00092025 predicted 278
11 SASI_Hs01_00092022 predicted 399
12 SASI_Hs01_00092026 predicted 275
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181756
ZNF233 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 233
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181756.1-441s1c1
Sequence:CCGGGCTGGCAAATATGGGAACAATCTCGAGATTGTTCCCATATTTGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181756.1-278s1c1
Sequence:CCGGCCCTTCAAACTAGATGTGATACTCGAGTATCACATCTAGTTTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181756.1-979s1c1
Sequence:CCGGGCCTCATGTAAATGTTGAGTACTCGAGTACTCAACATTTACATGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181756.1-1147s1c1
Sequence:CCGGCCTCTACAGATGTCAGGTATACTCGAGTATACCTGACATCTGTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181756.1-477s1c1
Sequence:CCGGCCAGTAATCAAGACCTAATAACTCGAGTTATTAGGTCTTGATTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181756.1-1414s21c1
Sequence:CCGGAGTAAGTGACAGGATATTTAACTCGAGTTAAATATCCTGTCACTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181756.1-866s21c1
Sequence:CCGGTCATCCCAGCATAGCATAATCCTCGAGGATTATGCTATGCTGGGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181756.1-2138s21c1
Sequence:CCGGTGATGGTGATGAATCTATTAACTCGAGTTAATAGATTCATCACCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181756
ZNF233 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 233
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181756.1-441s1c1
Sequence:CCGGGCTGGCAAATATGGGAACAATCTCGAGATTGTTCCCATATTTGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181756.1-278s1c1
Sequence:CCGGCCCTTCAAACTAGATGTGATACTCGAGTATCACATCTAGTTTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181756.1-979s1c1
Sequence:CCGGGCCTCATGTAAATGTTGAGTACTCGAGTACTCAACATTTACATGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181756.1-1147s1c1
Sequence:CCGGCCTCTACAGATGTCAGGTATACTCGAGTATACCTGACATCTGTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181756.1-477s1c1
Sequence:CCGGCCAGTAATCAAGACCTAATAACTCGAGTTATTAGGTCTTGATTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181756.1-1414s21c1
Sequence:CCGGAGTAAGTGACAGGATATTTAACTCGAGTTAAATATCCTGTCACTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181756.1-866s21c1
Sequence:CCGGTCATCCCAGCATAGCATAATCCTCGAGGATTATGCTATGCTGGGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181756.1-2138s21c1
Sequence:CCGGTGATGGTGATGAATCTATTAACTCGAGTTAATAGATTCATCACCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181756
ZNF233 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 233
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181756.1-441s1c1
Sequence:CCGGGCTGGCAAATATGGGAACAATCTCGAGATTGTTCCCATATTTGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181756.1-278s1c1
Sequence:CCGGCCCTTCAAACTAGATGTGATACTCGAGTATCACATCTAGTTTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181756.1-979s1c1
Sequence:CCGGGCCTCATGTAAATGTTGAGTACTCGAGTACTCAACATTTACATGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181756.1-1147s1c1
Sequence:CCGGCCTCTACAGATGTCAGGTATACTCGAGTATACCTGACATCTGTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181756.1-477s1c1
Sequence:CCGGCCAGTAATCAAGACCTAATAACTCGAGTTATTAGGTCTTGATTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181756.1-1414s21c1
Sequence:CCGGAGTAAGTGACAGGATATTTAACTCGAGTTAAATATCCTGTCACTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181756.1-866s21c1
Sequence:CCGGTCATCCCAGCATAGCATAATCCTCGAGGATTATGCTATGCTGGGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181756.1-2138s21c1
Sequence:CCGGTGATGGTGATGAATCTATTAACTCGAGTTAATAGATTCATCACCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks