EMAIL THIS PAGE TO A FRIEND

ZNF235

zinc finger protein 235

Synonyms: ANF270 HZF6 ZFP93 ZNF270
UniProtKB ID: Q14590, B4DTQ7, O14898, O14899, Q17RR8
Gene ID:
Human(9310) Summary: This gene product belongs to the zinc finger protein superfamily, members of which are regulatory proteins characterized by nucleic acid-binding zinc finger domains. The encoded protein is a member of the Kruppel family of zinc finger proteins, and contains Kruppel-associated box (KRAB) A and B domains and 15 tandemly arrayed C2H2-type zinc fingers. It is an ortholog of the mouse Zfp93 protein. This gene is located in a cluster of zinc finger genes on 19q13.2. [provided by RefSeq, Jul 2008]
cow(504436) zinc finger protein 235
naked mole-rat(101708915) zinc finger protein 235
Domestic Rabbit(100353135) zinc finger protein 235
domestic guinea pig(100730050) zinc finger protein 235
Horse(100070496) zinc finger protein 235
domestic cat(101090223) zinc finger protein 235
dog(100685629) zinc finger protein 235
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA045582 Anti-ZNF235 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004234 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004234 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004234 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU077991 MISSION® esiRNA esiRNA human ZNF235 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004234 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004234 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214358 predicted 1404
2 SASI_Hs01_00214359 predicted 1121
3 SASI_Hs01_00214361 predicted 992
4 SASI_Hs01_00214363 predicted 842
5 SASI_Hs01_00214364 predicted 237
6 SASI_Hs01_00214365 predicted 1399
7 SASI_Hs01_00214366 predicted 562
8 SASI_Hs01_00214367 predicted 897
9 SASI_Hs02_00337159 predicted 1395
10 SASI_Hs02_00337160 predicted 804
11 SASI_Hs01_00214360 predicted 1495
12 SASI_Hs01_00214362 predicted 1151
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004234
ZNF235 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 235
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004234.3-829s1c1
Sequence:CCGGCCCTAAAGGTATCACCTCTTACTCGAGTAAGAGGTGATACCTTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004234.3-1171s1c1
Sequence:CCGGGCTCACATCTTTATGCTCATTCTCGAGAATGAGCATAAAGATGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004234.3-992s1c1
Sequence:CCGGCACCAGTTATAGCTCAGGTATCTCGAGATACCTGAGCTATAACTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004234.3-2749s1c1
Sequence:CCGGGCCCAGCAATTACTGAAGAAACTCGAGTTTCTTCAGTAATTGCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004234.3-460s1c1
Sequence:CCGGCCACGATAAATATTGAAGGAACTCGAGTTCCTTCAATATTTATCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004234.4-360s21c1
Sequence:CCGGAGATGGCAACTCTTCACAAAGCTCGAGCTTTGTGAAGAGTTGCCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004234.4-2734s21c1
Sequence:CCGGGAATTGTGCTTGGCTCATAATCTCGAGATTATGAGCCAAGCACAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004234.4-564s21c1
Sequence:CCGGATGACAACTGTCTAGTGAATCCTCGAGGATTCACTAGACAGTTGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004234.4-2571s21c1
Sequence:CCGGTCCCGGTTCTCAAGATGTAACCTCGAGGTTACATCTTGAGAACCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004234.4-1764s21c1
Sequence:CCGGGGAGCTTGAATCTTCACAATCCTCGAGGATTGTGAAGATTCAAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004234.4-764s21c1
Sequence:CCGGTCACACCACCATGATGATAATCTCGAGATTATCATCATGGTGGTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004234.4-1404s21c1
Sequence:CCGGGGGATTGTGGTAAACGCTTTACTCGAGTAAAGCGTTTACCACAATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004234.4-722s21c1
Sequence:CCGGCTATGTATATTTGCTCCATATCTCGAGATATGGAGCAAATATACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004234.4-812s21c1
Sequence:CCGGAGCAATAGTGATTGTGGTAAACTCGAGTTTACCACAATCACTATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004234.4-429s21c1
Sequence:CCGGAGAGACACATTGCGAGCAAATCTCGAGATTTGCTCGCAATGTGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004234.4-2790s21c1
Sequence:CCGGACCTATAATTAGGACAAATACCTCGAGGTATTTGTCCTAATTATAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004234
ZNF235 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 235
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004234.3-829s1c1
Sequence:CCGGCCCTAAAGGTATCACCTCTTACTCGAGTAAGAGGTGATACCTTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004234.3-1171s1c1
Sequence:CCGGGCTCACATCTTTATGCTCATTCTCGAGAATGAGCATAAAGATGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004234.3-992s1c1
Sequence:CCGGCACCAGTTATAGCTCAGGTATCTCGAGATACCTGAGCTATAACTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004234.3-2749s1c1
Sequence:CCGGGCCCAGCAATTACTGAAGAAACTCGAGTTTCTTCAGTAATTGCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004234.3-460s1c1
Sequence:CCGGCCACGATAAATATTGAAGGAACTCGAGTTCCTTCAATATTTATCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004234.4-360s21c1
Sequence:CCGGAGATGGCAACTCTTCACAAAGCTCGAGCTTTGTGAAGAGTTGCCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004234.4-2734s21c1
Sequence:CCGGGAATTGTGCTTGGCTCATAATCTCGAGATTATGAGCCAAGCACAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004234.4-564s21c1
Sequence:CCGGATGACAACTGTCTAGTGAATCCTCGAGGATTCACTAGACAGTTGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004234.4-2571s21c1
Sequence:CCGGTCCCGGTTCTCAAGATGTAACCTCGAGGTTACATCTTGAGAACCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004234.4-1764s21c1
Sequence:CCGGGGAGCTTGAATCTTCACAATCCTCGAGGATTGTGAAGATTCAAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004234.4-764s21c1
Sequence:CCGGTCACACCACCATGATGATAATCTCGAGATTATCATCATGGTGGTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004234.4-1404s21c1
Sequence:CCGGGGGATTGTGGTAAACGCTTTACTCGAGTAAAGCGTTTACCACAATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004234.4-722s21c1
Sequence:CCGGCTATGTATATTTGCTCCATATCTCGAGATATGGAGCAAATATACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004234.4-812s21c1
Sequence:CCGGAGCAATAGTGATTGTGGTAAACTCGAGTTTACCACAATCACTATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004234.4-429s21c1
Sequence:CCGGAGAGACACATTGCGAGCAAATCTCGAGATTTGCTCGCAATGTGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004234.4-2790s21c1
Sequence:CCGGACCTATAATTAGGACAAATACCTCGAGGTATTTGTCCTAATTATAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004234
ZNF235 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 235
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004234.3-829s1c1
Sequence:CCGGCCCTAAAGGTATCACCTCTTACTCGAGTAAGAGGTGATACCTTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004234.3-1171s1c1
Sequence:CCGGGCTCACATCTTTATGCTCATTCTCGAGAATGAGCATAAAGATGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004234.3-992s1c1
Sequence:CCGGCACCAGTTATAGCTCAGGTATCTCGAGATACCTGAGCTATAACTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004234.3-2749s1c1
Sequence:CCGGGCCCAGCAATTACTGAAGAAACTCGAGTTTCTTCAGTAATTGCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004234.3-460s1c1
Sequence:CCGGCCACGATAAATATTGAAGGAACTCGAGTTCCTTCAATATTTATCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004234.4-360s21c1
Sequence:CCGGAGATGGCAACTCTTCACAAAGCTCGAGCTTTGTGAAGAGTTGCCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004234.4-2734s21c1
Sequence:CCGGGAATTGTGCTTGGCTCATAATCTCGAGATTATGAGCCAAGCACAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004234.4-564s21c1
Sequence:CCGGATGACAACTGTCTAGTGAATCCTCGAGGATTCACTAGACAGTTGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004234.4-2571s21c1
Sequence:CCGGTCCCGGTTCTCAAGATGTAACCTCGAGGTTACATCTTGAGAACCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004234.4-1764s21c1
Sequence:CCGGGGAGCTTGAATCTTCACAATCCTCGAGGATTGTGAAGATTCAAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004234.4-764s21c1
Sequence:CCGGTCACACCACCATGATGATAATCTCGAGATTATCATCATGGTGGTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004234.4-1404s21c1
Sequence:CCGGGGGATTGTGGTAAACGCTTTACTCGAGTAAAGCGTTTACCACAATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004234.4-722s21c1
Sequence:CCGGCTATGTATATTTGCTCCATATCTCGAGATATGGAGCAAATATACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004234.4-812s21c1
Sequence:CCGGAGCAATAGTGATTGTGGTAAACTCGAGTTTACCACAATCACTATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004234.4-429s21c1
Sequence:CCGGAGAGACACATTGCGAGCAAATCTCGAGATTTGCTCGCAATGTGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004234.4-2790s21c1
Sequence:CCGGACCTATAATTAGGACAAATACCTCGAGGTATTTGTCCTAATTATAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks