EMAIL THIS PAGE TO A FRIEND

ZNF236

zinc finger protein 236

Synonyms: ZNF236A ZNF236B
UniProtKB ID: Q9UL36, B2RTX9, Q9UL37
Gene ID:
Zebrafish(572232) zinc finger protein 236
Horse(100063239) zinc finger protein 236
domestic cat(101100253) zinc finger protein 236
dog(483929) zinc finger protein 236
chicken(421008) zinc finger protein 236
domestic guinea pig(100727742) zinc finger protein 236
Domestic Rabbit(100344876) zinc finger protein 236
naked mole-rat(101703548) zinc finger protein 236
cow(535214) zinc finger protein 236
sheep(101109665) zinc finger protein 236
153 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007345 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007345 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007345 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU071851 MISSION® esiRNA esiRNA human ZNF236 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007345 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007345 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343432 predicted 1100
2 SASI_Hs01_00179185 predicted 733
3 SASI_Hs01_00179186 predicted 3496
4 SASI_Hs01_00179187 predicted 4912
5 SASI_Hs01_00179189 predicted 2523
6 SASI_Hs01_00179191 predicted 2144
7 SASI_Hs01_00179192 predicted 776
8 SASI_Hs01_00179193 predicted 4132
9 SASI_Hs02_00343433 predicted 1026
10 SASI_Hs01_00179194 predicted 4291
11 SASI_Hs01_00179188 predicted 1965
12 SASI_Hs01_00179190 predicted 285
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007345
VALIDATED
ZNF236 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 236
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007345.3-737s21c1
Sequence:CCGGTATCAAGTACAAGGTCTTATACTCGAGTATAAGACCTTGTACTTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007345.3-6462s21c1
Sequence:CCGGTTCAGGTCCAGGGTTACATAACTCGAGTTATGTAACCCTGGACCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007345.3-2403s21c1
Sequence:CCGGCAACGACCTTCGTCCCTATATCTCGAGATATAGGGACGAAGGTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007345.3-515s21c1
Sequence:CCGGCTAGTCTCAAAGCGCATATTACTCGAGTAATATGCGCTTTGAGACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007345.3-2017s21c1
Sequence:CCGGCGTGTTGGCAAGACGAATATTCTCGAGAATATTCGTCTTGCCAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007345.1-6516s1c1
Sequence:CCGGCGACACACTTACCGCATCAATCTCGAGATTGATGCGGTAAGTGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007345.1-483s1c1
Sequence:CCGGCCCTGTGTGTAACAAGAAATTCTCGAGAATTTCTTGTTACACACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007345.1-2065s1c1
Sequence:CCGGCCAATCCTCATAACTGACTTACTCGAGTAAGTCAGTTATGAGGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007345.1-4294s1c1
Sequence:CCGGGCTAACTTGGTTGGACCAAATCTCGAGATTTGGTCCAACCAAGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007345.1-2413s1c1
Sequence:CCGGCGTCCCTATATGTGTCCCTATCTCGAGATAGGGACACATATAGGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007345
VALIDATED
ZNF236 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 236
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007345.3-737s21c1
Sequence:CCGGTATCAAGTACAAGGTCTTATACTCGAGTATAAGACCTTGTACTTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007345.3-6462s21c1
Sequence:CCGGTTCAGGTCCAGGGTTACATAACTCGAGTTATGTAACCCTGGACCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007345.3-2403s21c1
Sequence:CCGGCAACGACCTTCGTCCCTATATCTCGAGATATAGGGACGAAGGTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007345.3-515s21c1
Sequence:CCGGCTAGTCTCAAAGCGCATATTACTCGAGTAATATGCGCTTTGAGACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007345.3-2017s21c1
Sequence:CCGGCGTGTTGGCAAGACGAATATTCTCGAGAATATTCGTCTTGCCAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007345.1-6516s1c1
Sequence:CCGGCGACACACTTACCGCATCAATCTCGAGATTGATGCGGTAAGTGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007345.1-483s1c1
Sequence:CCGGCCCTGTGTGTAACAAGAAATTCTCGAGAATTTCTTGTTACACACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007345.1-2065s1c1
Sequence:CCGGCCAATCCTCATAACTGACTTACTCGAGTAAGTCAGTTATGAGGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007345.1-4294s1c1
Sequence:CCGGGCTAACTTGGTTGGACCAAATCTCGAGATTTGGTCCAACCAAGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007345.1-2413s1c1
Sequence:CCGGCGTCCCTATATGTGTCCCTATCTCGAGATAGGGACACATATAGGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007345
VALIDATED
ZNF236 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 236
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007345.3-737s21c1
Sequence:CCGGTATCAAGTACAAGGTCTTATACTCGAGTATAAGACCTTGTACTTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007345.3-6462s21c1
Sequence:CCGGTTCAGGTCCAGGGTTACATAACTCGAGTTATGTAACCCTGGACCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007345.3-2403s21c1
Sequence:CCGGCAACGACCTTCGTCCCTATATCTCGAGATATAGGGACGAAGGTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007345.3-515s21c1
Sequence:CCGGCTAGTCTCAAAGCGCATATTACTCGAGTAATATGCGCTTTGAGACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007345.3-2017s21c1
Sequence:CCGGCGTGTTGGCAAGACGAATATTCTCGAGAATATTCGTCTTGCCAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007345.1-6516s1c1
Sequence:CCGGCGACACACTTACCGCATCAATCTCGAGATTGATGCGGTAAGTGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007345.1-483s1c1
Sequence:CCGGCCCTGTGTGTAACAAGAAATTCTCGAGAATTTCTTGTTACACACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007345.1-2065s1c1
Sequence:CCGGCCAATCCTCATAACTGACTTACTCGAGTAAGTCAGTTATGAGGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007345.1-4294s1c1
Sequence:CCGGGCTAACTTGGTTGGACCAAATCTCGAGATTTGGTCCAACCAAGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007345.1-2413s1c1
Sequence:CCGGCGTCCCTATATGTGTCCCTATCTCGAGATAGGGACACATATAGGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks