EMAIL THIS PAGE TO A FRIEND

ZNF239

zinc finger protein 239

Synonyms: HOK-2 MOK2
UniProtKB ID: Q16600, Q5T1G9, Q8TAS5
Gene ID:
Human(8187) Summary: MOK2 proteins are DNA- and RNA-binding proteins that are mainly associated with nuclear RNP components, including the nucleoli and extranucleolar structures (Arranz et al., 1997 [PubMed 9121460]
domestic cat(101081929) zinc finger protein 239
dog(100683273) zinc finger protein 239
naked mole-rat(101724217) zinc finger protein 239
domestic guinea pig(101788855) zinc finger protein 239
cow(100848535) zinc finger protein 239
sheep(101119183) zinc finger protein 239
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005674 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005674 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005674 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132471 MISSION® esiRNA esiRNA human ZNF239 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099282 Rosetta Predictions human pricing
NM_001099283 Rosetta Predictions human pricing
NM_001099284 Rosetta Predictions human pricing
NM_005674 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320387 predicted 535
2 SASI_Hs02_00320388 predicted 545
3 SASI_Hs02_00320389 predicted 559
4 SASI_Hs02_00320390 predicted 961
5 SASI_Hs02_00320391 predicted 1683
6 SASI_Hs02_00320392 predicted 1558
7 SASI_Hs02_00320393 predicted 557
8 SASI_Hs02_00320394 predicted 970
9 SASI_Hs02_00320395 predicted 527
10 SASI_Hs02_00320396 predicted 1490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320397 predicted 376
2 SASI_Hs02_00320398 predicted 385
3 SASI_Hs02_00320399 predicted 396
4 SASI_Hs02_00320400 predicted 802
5 SASI_Hs02_00320401 predicted 1527
6 SASI_Hs02_00320402 predicted 1395
7 SASI_Hs02_00320403 predicted 391
8 SASI_Hs02_00320404 predicted 811
9 SASI_Hs02_00320405 predicted 363
10 SASI_Hs02_00320406 predicted 1329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320407 predicted 496
2 SASI_Hs02_00320408 predicted 507
3 SASI_Hs02_00320409 predicted 521
4 SASI_Hs02_00320410 predicted 921
5 SASI_Hs02_00320411 predicted 1646
6 SASI_Hs02_00320412 predicted 1522
7 SASI_Hs02_00320413 predicted 514
8 SASI_Hs02_00320414 predicted 927
9 SASI_Hs02_00320415 predicted 492
10 SASI_Hs02_00320416 predicted 1456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005674 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340063 predicted 861
2 SASI_Hs01_00110336 predicted 871
3 SASI_Hs01_00110338 predicted 874
4 SASI_Hs01_00110339 predicted 1288
5 SASI_Hs01_00110340 predicted 2003
6 SASI_Hs01_00110341 predicted 1876
7 SASI_Hs02_00340064 predicted 874
8 SASI_Hs01_00110343 predicted 1286
9 SASI_Hs01_00110344 predicted 846
10 SASI_Hs01_00110345 predicted 1817
11 SASI_Hs01_00110337 predicted 1520
12 SASI_Hs01_00110342 predicted 678
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005674
ZNF239 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 239
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005674.1-2194s1c1
Sequence:CCGGGCACTTTGTTATGCTGTACAACTCGAGTTGTACAGCATAACAAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005674.1-1002s1c1
Sequence:CCGGCAAGTTAAACTGGTGTCTGATCTCGAGATCAGACACCAGTTTAACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005674.1-1892s1c1
Sequence:CCGGCCAGAGTTCCAAACTCCTCATCTCGAGATGAGGAGTTTGGAACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005674.1-797s1c1
Sequence:CCGGGACTCTTCAAAGTGGTTGTTTCTCGAGAAACAACCACTTTGAAGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005674.1-1489s1c1
Sequence:CCGGTCATCCATCATGCCGTCCATACTCGAGTATGGACGGCATGATGGATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005674.2-2020s21c1
Sequence:CCGGATCCTCGCTAACTGACATTAGCTCGAGCTAATGTCAGTTAGCGAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005674.2-1154s21c1
Sequence:CCGGTAGTCAGCAGAGAGCTCATACCTCGAGGTATGAGCTCTCTGCTGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005674.2-2121s21c1
Sequence:CCGGAGAGAGATGTAAGGGTTATTTCTCGAGAAATAACCCTTACATCTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005674.2-2048s21c1
Sequence:CCGGAGGTCTTCACAGCGCTCATACCTCGAGGTATGAGCGCTGTGAAGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005674
ZNF239 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 239
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005674.1-2194s1c1
Sequence:CCGGGCACTTTGTTATGCTGTACAACTCGAGTTGTACAGCATAACAAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005674.1-1002s1c1
Sequence:CCGGCAAGTTAAACTGGTGTCTGATCTCGAGATCAGACACCAGTTTAACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005674.1-1892s1c1
Sequence:CCGGCCAGAGTTCCAAACTCCTCATCTCGAGATGAGGAGTTTGGAACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005674.1-797s1c1
Sequence:CCGGGACTCTTCAAAGTGGTTGTTTCTCGAGAAACAACCACTTTGAAGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005674.1-1489s1c1
Sequence:CCGGTCATCCATCATGCCGTCCATACTCGAGTATGGACGGCATGATGGATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005674.2-2020s21c1
Sequence:CCGGATCCTCGCTAACTGACATTAGCTCGAGCTAATGTCAGTTAGCGAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005674.2-1154s21c1
Sequence:CCGGTAGTCAGCAGAGAGCTCATACCTCGAGGTATGAGCTCTCTGCTGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005674.2-2121s21c1
Sequence:CCGGAGAGAGATGTAAGGGTTATTTCTCGAGAAATAACCCTTACATCTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005674.2-2048s21c1
Sequence:CCGGAGGTCTTCACAGCGCTCATACCTCGAGGTATGAGCGCTGTGAAGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005674
ZNF239 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 239
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005674.1-2194s1c1
Sequence:CCGGGCACTTTGTTATGCTGTACAACTCGAGTTGTACAGCATAACAAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005674.1-1002s1c1
Sequence:CCGGCAAGTTAAACTGGTGTCTGATCTCGAGATCAGACACCAGTTTAACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005674.1-1892s1c1
Sequence:CCGGCCAGAGTTCCAAACTCCTCATCTCGAGATGAGGAGTTTGGAACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005674.1-797s1c1
Sequence:CCGGGACTCTTCAAAGTGGTTGTTTCTCGAGAAACAACCACTTTGAAGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005674.1-1489s1c1
Sequence:CCGGTCATCCATCATGCCGTCCATACTCGAGTATGGACGGCATGATGGATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005674.2-2020s21c1
Sequence:CCGGATCCTCGCTAACTGACATTAGCTCGAGCTAATGTCAGTTAGCGAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005674.2-1154s21c1
Sequence:CCGGTAGTCAGCAGAGAGCTCATACCTCGAGGTATGAGCTCTCTGCTGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005674.2-2121s21c1
Sequence:CCGGAGAGAGATGTAAGGGTTATTTCTCGAGAAATAACCCTTACATCTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005674.2-2048s21c1
Sequence:CCGGAGGTCTTCACAGCGCTCATACCTCGAGGTATGAGCGCTGTGAAGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks