EMAIL THIS PAGE TO A FRIEND

ZNF248

zinc finger protein 248

Synonyms: bA162G10.3
UniProtKB ID: Q8NDW4, Q8NDV8, Q9UMP3
Gene ID:
dog(479184) zinc finger protein 248
domestic cat(101094626) zinc finger protein 248
Horse(100056241) zinc finger protein 248
naked mole-rat(101716514) zinc finger protein 248
Domestic Rabbit(100340451) zinc finger protein 248
domestic guinea pig(100733105) zinc finger protein 248
cow(784893) zinc finger protein 248
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021045 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021045 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021045 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021045 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092068 predicted 1043
2 SASI_Hs01_00092069 predicted 2263
3 SASI_Hs02_00354516 predicted 2212
4 SASI_Hs01_00092070 predicted 1315
5 SASI_Hs01_00092071 predicted 1090
6 SASI_Hs01_00092073 predicted 2217
7 SASI_Hs01_00092074 predicted 797
8 SASI_Hs01_00092075 predicted 683
9 SASI_Hs01_00092076 predicted 1008
10 SASI_Hs02_00354517 predicted 1197
11 SASI_Hs01_00092067 predicted 985
12 SASI_Hs01_00092072 predicted 1055
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021045
VALIDATED
ZNF248 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 248
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021045.1-2211s1c1
Sequence:CCGGCAAGGGTGAAAGCTCTTTCAACTCGAGTTGAAAGAGCTTTCACCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021045.1-1770s1c1
Sequence:CCGGCCAACCATCAGCGAACACATACTCGAGTATGTGTTCGCTGATGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021045.1-1091s1c1
Sequence:CCGGGCCATTAATTATCACCAGGATCTCGAGATCCTGGTGATAATTAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021045.1-665s1c1
Sequence:CCGGGTGATCTTTAAGATCGAGCAACTCGAGTTGCTCGATCTTAAAGATCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021045.1-1289s1c1
Sequence:CCGGCATTTGGAAATGGAGCCGTATCTCGAGATACGGCTCCATTTCCAAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021045.1-654s21c1
Sequence:CCGGCTAAACCAGAAGTGATCTTTACTCGAGTAAAGATCACTTCTGGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021045.1-1460s21c1
Sequence:CCGGAGAAAGATTCTCCGTGAATATCTCGAGATATTCACGGAGAATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_021045.1-3424s21c1
Sequence:CCGGTTGTAGGTTGGCCAGTATATGCTCGAGCATATACTGGCCAACCTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021045.1-1015s21c1
Sequence:CCGGGAAATTGCTCCTTGATATTAGCTCGAGCTAATATCAAGGAGCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021045.1-950s21c1
Sequence:CCGGTCGGGCTTAATTATTAGTAAACTCGAGTTTACTAATAATTAAGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021045
VALIDATED
ZNF248 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 248
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021045.1-2211s1c1
Sequence:CCGGCAAGGGTGAAAGCTCTTTCAACTCGAGTTGAAAGAGCTTTCACCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021045.1-1770s1c1
Sequence:CCGGCCAACCATCAGCGAACACATACTCGAGTATGTGTTCGCTGATGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021045.1-1091s1c1
Sequence:CCGGGCCATTAATTATCACCAGGATCTCGAGATCCTGGTGATAATTAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021045.1-665s1c1
Sequence:CCGGGTGATCTTTAAGATCGAGCAACTCGAGTTGCTCGATCTTAAAGATCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021045.1-1289s1c1
Sequence:CCGGCATTTGGAAATGGAGCCGTATCTCGAGATACGGCTCCATTTCCAAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021045.1-654s21c1
Sequence:CCGGCTAAACCAGAAGTGATCTTTACTCGAGTAAAGATCACTTCTGGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021045.1-1460s21c1
Sequence:CCGGAGAAAGATTCTCCGTGAATATCTCGAGATATTCACGGAGAATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_021045.1-3424s21c1
Sequence:CCGGTTGTAGGTTGGCCAGTATATGCTCGAGCATATACTGGCCAACCTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021045.1-1015s21c1
Sequence:CCGGGAAATTGCTCCTTGATATTAGCTCGAGCTAATATCAAGGAGCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021045.1-950s21c1
Sequence:CCGGTCGGGCTTAATTATTAGTAAACTCGAGTTTACTAATAATTAAGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021045
VALIDATED
ZNF248 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 248
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021045.1-2211s1c1
Sequence:CCGGCAAGGGTGAAAGCTCTTTCAACTCGAGTTGAAAGAGCTTTCACCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021045.1-1770s1c1
Sequence:CCGGCCAACCATCAGCGAACACATACTCGAGTATGTGTTCGCTGATGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021045.1-1091s1c1
Sequence:CCGGGCCATTAATTATCACCAGGATCTCGAGATCCTGGTGATAATTAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021045.1-665s1c1
Sequence:CCGGGTGATCTTTAAGATCGAGCAACTCGAGTTGCTCGATCTTAAAGATCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021045.1-1289s1c1
Sequence:CCGGCATTTGGAAATGGAGCCGTATCTCGAGATACGGCTCCATTTCCAAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021045.1-654s21c1
Sequence:CCGGCTAAACCAGAAGTGATCTTTACTCGAGTAAAGATCACTTCTGGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021045.1-1460s21c1
Sequence:CCGGAGAAAGATTCTCCGTGAATATCTCGAGATATTCACGGAGAATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_021045.1-3424s21c1
Sequence:CCGGTTGTAGGTTGGCCAGTATATGCTCGAGCATATACTGGCCAACCTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021045.1-1015s21c1
Sequence:CCGGGAAATTGCTCCTTGATATTAGCTCGAGCTAATATCAAGGAGCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021045.1-950s21c1
Sequence:CCGGTCGGGCTTAATTATTAGTAAACTCGAGTTTACTAATAATTAAGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks