EMAIL THIS PAGE TO A FRIEND

ZNF24

zinc finger protein 24

Synonyms: KOX17 RSG-A ZNF191 ZSCAN3 Zfp191
UniProtKB ID: P17028, O14754, Q53YE4, Q6ICR5, Q8IZN4
Gene ID:
cow(538969) zinc finger protein 24
sheep(101110637) zinc finger protein 24
domestic guinea pig(101787907) zinc finger protein 24
naked mole-rat(101706404) zinc finger protein 24
dog(480162) zinc finger protein 24
domestic cat(101093466) zinc finger protein 24
Horse(100052725) zinc finger protein 24
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006965 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006965 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006965 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021231 MISSION® esiRNA esiRNA human ZNF24 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006965 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070024 predicted 911
2 SASI_Hs01_00070025 predicted 733
3 SASI_Hs01_00070027 predicted 775
4 SASI_Hs02_00342704 predicted 576
5 SASI_Hs01_00070029 predicted 1026
6 SASI_Hs01_00070030 predicted 1022
7 SASI_Hs01_00070031 predicted 457
8 SASI_Hs01_00070032 predicted 790
9 SASI_Hs01_00070033 predicted 798
10 SASI_Hs02_00342705 predicted 579
11 SASI_Hs01_00070026 predicted 994
12 SASI_Hs01_00070028 predicted 995
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006965
VALIDATED
ZNF24 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 24
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006965.2-568s21c1
Sequence:CCGGGAGGATTTGGAGAGTGAACTTCTCGAGAAGTTCACTCTCCAAATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006965.2-1588s21c1
Sequence:CCGGCCCTTTCTTGAAAGTTTCTTTCTCGAGAAAGAAACTTTCAAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006965.2-286s21c1
Sequence:CCGGGGCGAAGAGGGATCAAGTATCCTCGAGGATACTTGATCCCTCTTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006965.2-845s21c1
Sequence:CCGGATATGGGTGTTCCTCAAATTTCTCGAGAAATTTGAGGAACACCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006965.1-1567s1c1
Sequence:CCGGCCCTTTCTTGAAAGTTTCTTTCTCGAGAAAGAAACTTTCAAGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006965.1-546s1c1
Sequence:CCGGGAGGATTTGGAGAGTGAACTTCTCGAGAAGTTCACTCTCCAAATCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006965.1-1032s1c1
Sequence:CCGGCGAAGTTCCATTCTTGTGCAACTCGAGTTGCACAAGAATGGAACTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006965.1-899s1c1
Sequence:CCGGCTCTCGAAAGAAACAACATATCTCGAGATATGTTGTTTCTTTCGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006965.1-789s1c1
Sequence:CCGGGCATTAGAATCCCATGAAGTTCTCGAGAACTTCATGGGATTCTAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006965
VALIDATED
ZNF24 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 24
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006965.2-568s21c1
Sequence:CCGGGAGGATTTGGAGAGTGAACTTCTCGAGAAGTTCACTCTCCAAATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006965.2-1588s21c1
Sequence:CCGGCCCTTTCTTGAAAGTTTCTTTCTCGAGAAAGAAACTTTCAAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006965.2-286s21c1
Sequence:CCGGGGCGAAGAGGGATCAAGTATCCTCGAGGATACTTGATCCCTCTTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006965.2-845s21c1
Sequence:CCGGATATGGGTGTTCCTCAAATTTCTCGAGAAATTTGAGGAACACCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006965.1-1567s1c1
Sequence:CCGGCCCTTTCTTGAAAGTTTCTTTCTCGAGAAAGAAACTTTCAAGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006965.1-546s1c1
Sequence:CCGGGAGGATTTGGAGAGTGAACTTCTCGAGAAGTTCACTCTCCAAATCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006965.1-1032s1c1
Sequence:CCGGCGAAGTTCCATTCTTGTGCAACTCGAGTTGCACAAGAATGGAACTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006965.1-899s1c1
Sequence:CCGGCTCTCGAAAGAAACAACATATCTCGAGATATGTTGTTTCTTTCGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006965.1-789s1c1
Sequence:CCGGGCATTAGAATCCCATGAAGTTCTCGAGAACTTCATGGGATTCTAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006965
VALIDATED
ZNF24 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 24
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006965.2-568s21c1
Sequence:CCGGGAGGATTTGGAGAGTGAACTTCTCGAGAAGTTCACTCTCCAAATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006965.2-1588s21c1
Sequence:CCGGCCCTTTCTTGAAAGTTTCTTTCTCGAGAAAGAAACTTTCAAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006965.2-286s21c1
Sequence:CCGGGGCGAAGAGGGATCAAGTATCCTCGAGGATACTTGATCCCTCTTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006965.2-845s21c1
Sequence:CCGGATATGGGTGTTCCTCAAATTTCTCGAGAAATTTGAGGAACACCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006965.1-1567s1c1
Sequence:CCGGCCCTTTCTTGAAAGTTTCTTTCTCGAGAAAGAAACTTTCAAGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006965.1-546s1c1
Sequence:CCGGGAGGATTTGGAGAGTGAACTTCTCGAGAAGTTCACTCTCCAAATCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006965.1-1032s1c1
Sequence:CCGGCGAAGTTCCATTCTTGTGCAACTCGAGTTGCACAAGAATGGAACTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006965.1-899s1c1
Sequence:CCGGCTCTCGAAAGAAACAACATATCTCGAGATATGTTGTTTCTTTCGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006965.1-789s1c1
Sequence:CCGGGCATTAGAATCCCATGAAGTTCTCGAGAACTTCATGGGATTCTAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks