EMAIL THIS PAGE TO A FRIEND

ZNF250

zinc finger protein 250

Synonyms: ZFP647 ZNF647
UniProtKB ID: P15622, D3DWP1, Q59HE9, Q8N942, Q96AH9
Gene ID:
Horse(100147638) zinc finger protein 250
domestic cat(101082721) zinc finger protein 250
dog(100683615) zinc finger protein 250
naked mole-rat(101701771) zinc finger protein 250
Domestic Rabbit(100355756) zinc finger protein 250
domestic guinea pig(100718178) zinc finger protein 250
cow(789384) zinc finger protein 250
cow(523461) zinc finger protein 250
sheep(101111293) zinc finger protein 250
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021061 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021061 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021061 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001109689 Rosetta Predictions human pricing
NM_021061 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109689 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324713 predicted 1765
2 SASI_Hs02_00324714 predicted 1027
3 SASI_Hs02_00324715 predicted 897
4 SASI_Hs02_00324716 predicted 495
5 SASI_Hs02_00324717 predicted 1861
6 SASI_Hs02_00324718 predicted 695
7 SASI_Hs02_00324719 predicted 1848
8 SASI_Hs02_00324720 predicted 1462
9 SASI_Hs02_00324721 predicted 1816
10 SASI_Hs02_00324722 predicted 1609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021061 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068959 predicted 1780
2 SASI_Hs01_00068960 predicted 1043
3 SASI_Hs02_00354531 predicted 913
4 SASI_Hs01_00068962 predicted 512
5 SASI_Hs01_00068963 predicted 1876
6 SASI_Hs01_00068964 predicted 705
7 SASI_Hs01_00068965 predicted 1860
8 SASI_Hs01_00068966 predicted 1476
9 SASI_Hs01_00068967 predicted 1830
10 SASI_Hs02_00354532 predicted 1630
11 SASI_Hs01_00068961 predicted 297
12 SASI_Hs01_00068968 predicted 264
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021061
ZNF250 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 250
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021061.1-260s1c1
Sequence:CCGGCCTATGGGAATGTAGTCTCATCTCGAGATGAGACTACATTCCCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021061.1-388s1c1
Sequence:CCGGGACTACTCAGACAACCTCAAACTCGAGTTTGAGGTTGTCTGAGTAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021061.1-907s1c1
Sequence:CCGGCTTGCTCAGCATCACAAGATACTCGAGTATCTTGTGATGCTGAGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021061.1-1563s1c1
Sequence:CCGGCAGCCTGAAAGCAACTCTGATCTCGAGATCAGAGTTGCTTTCAGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021061.1-619s1c1
Sequence:CCGGCACCGTGAAGTTCAGGTCTTACTCGAGTAAGACCTGAACTTCACGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021061.3-639s21c1
Sequence:CCGGCCGTGAAGTTCAGGTCTTAAGCTCGAGCTTAAGACCTGAACTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021061.3-3136s21c1
Sequence:CCGGCAGTATCCATTGCCATATTACCTCGAGGTAATATGGCAATGGATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021061.3-514s21c1
Sequence:CCGGTTGAGTCCGAAGCCATTAATTCTCGAGAATTAATGGCTTCGGACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021061.3-409s21c1
Sequence:CCGGTACTCAGACAACCTCAAATATCTCGAGATATTTGAGGTTGTCTGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021061
ZNF250 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 250
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021061.1-260s1c1
Sequence:CCGGCCTATGGGAATGTAGTCTCATCTCGAGATGAGACTACATTCCCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021061.1-388s1c1
Sequence:CCGGGACTACTCAGACAACCTCAAACTCGAGTTTGAGGTTGTCTGAGTAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021061.1-907s1c1
Sequence:CCGGCTTGCTCAGCATCACAAGATACTCGAGTATCTTGTGATGCTGAGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021061.1-1563s1c1
Sequence:CCGGCAGCCTGAAAGCAACTCTGATCTCGAGATCAGAGTTGCTTTCAGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021061.1-619s1c1
Sequence:CCGGCACCGTGAAGTTCAGGTCTTACTCGAGTAAGACCTGAACTTCACGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021061.3-639s21c1
Sequence:CCGGCCGTGAAGTTCAGGTCTTAAGCTCGAGCTTAAGACCTGAACTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021061.3-3136s21c1
Sequence:CCGGCAGTATCCATTGCCATATTACCTCGAGGTAATATGGCAATGGATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021061.3-514s21c1
Sequence:CCGGTTGAGTCCGAAGCCATTAATTCTCGAGAATTAATGGCTTCGGACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021061.3-409s21c1
Sequence:CCGGTACTCAGACAACCTCAAATATCTCGAGATATTTGAGGTTGTCTGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021061
ZNF250 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 250
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021061.1-260s1c1
Sequence:CCGGCCTATGGGAATGTAGTCTCATCTCGAGATGAGACTACATTCCCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021061.1-388s1c1
Sequence:CCGGGACTACTCAGACAACCTCAAACTCGAGTTTGAGGTTGTCTGAGTAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021061.1-907s1c1
Sequence:CCGGCTTGCTCAGCATCACAAGATACTCGAGTATCTTGTGATGCTGAGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021061.1-1563s1c1
Sequence:CCGGCAGCCTGAAAGCAACTCTGATCTCGAGATCAGAGTTGCTTTCAGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021061.1-619s1c1
Sequence:CCGGCACCGTGAAGTTCAGGTCTTACTCGAGTAAGACCTGAACTTCACGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021061.3-639s21c1
Sequence:CCGGCCGTGAAGTTCAGGTCTTAAGCTCGAGCTTAAGACCTGAACTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021061.3-3136s21c1
Sequence:CCGGCAGTATCCATTGCCATATTACCTCGAGGTAATATGGCAATGGATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021061.3-514s21c1
Sequence:CCGGTTGAGTCCGAAGCCATTAATTCTCGAGAATTAATGGCTTCGGACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021061.3-409s21c1
Sequence:CCGGTACTCAGACAACCTCAAATATCTCGAGATATTTGAGGTTGTCTGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks