EMAIL THIS PAGE TO A FRIEND

ZNF251

zinc finger protein 251

Species: Human ZNF251(90987), domestic guinea pig Znf251(100712981), Horse ZNF251(100064391)
UniProtKB ID: Q9BRH9, Q2M219
Gene ID:
domestic guinea pig(100712981) zinc finger protein 251
Horse(100064391) zinc finger protein 251
29 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138367 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138367 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138367 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153711 MISSION® esiRNA esiRNA human ZNF251 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138367 Rosetta Predictions human pricing
XM_291262 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363467 predicted 1886
2 SASI_Hs02_00363468 predicted 611
3 SASI_Hs02_00363469 predicted 2105
4 SASI_Hs02_00363470 predicted 797
5 SASI_Hs02_00363471 predicted 462
6 SASI_Hs02_00363472 predicted 719
7 SASI_Hs02_00363473 predicted 2327
8 SASI_Hs02_00363474 predicted 2346
9 SASI_Hs02_00363475 predicted 996
10 SASI_Hs02_00363476 predicted 1172
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_291262 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00284671 predicted 1971
2 SASI_Hs01_00284672 predicted 692
3 SASI_Hs01_00284673 predicted 2180
4 SASI_Hs01_00284674 predicted 1060
5 SASI_Hs01_00284675 predicted 879
6 SASI_Hs01_00284676 predicted 541
7 SASI_Hs01_00284677 predicted 2399
8 SASI_Hs01_00284678 predicted 2422
9 SASI_Hs01_00284679 predicted 1077
10 SASI_Hs01_00284680 predicted 1247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138367
VALIDATED
ZNF251 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 251
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138367.1-1435s21c1
Sequence:CCGGCCTCCATCATCGGGTTCATACCTCGAGGTATGAACCCGATGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_138367.1-717s21c1
Sequence:GTACCGGGTTTGAACAAACCCAATATTCCTCGAGGAATATTGGGTTTGTTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138367.1-2381s21c1
Sequence:CCGGATAGTTCAGATGACTACTAAACTCGAGTTTAGTAGTCATCTGAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138367.1-1164s21c1
Sequence:CCGGGTCGAAGCTCAACTCTTATTCCTCGAGGAATAAGAGTTGAGCTTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138367.1-609s21c1
Sequence:CCGGTTGTATCAAGAAGACTCTTAACTCGAGTTAAGAGTCTTCTTGATACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138367
VALIDATED
ZNF251 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 251
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138367.1-1435s21c1
Sequence:CCGGCCTCCATCATCGGGTTCATACCTCGAGGTATGAACCCGATGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_138367.1-717s21c1
Sequence:GTACCGGGTTTGAACAAACCCAATATTCCTCGAGGAATATTGGGTTTGTTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138367.1-2381s21c1
Sequence:CCGGATAGTTCAGATGACTACTAAACTCGAGTTTAGTAGTCATCTGAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138367.1-1164s21c1
Sequence:CCGGGTCGAAGCTCAACTCTTATTCCTCGAGGAATAAGAGTTGAGCTTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138367.1-609s21c1
Sequence:CCGGTTGTATCAAGAAGACTCTTAACTCGAGTTAAGAGTCTTCTTGATACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138367
VALIDATED
ZNF251 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 251
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138367.1-1435s21c1
Sequence:CCGGCCTCCATCATCGGGTTCATACCTCGAGGTATGAACCCGATGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_138367.1-717s21c1
Sequence:GTACCGGGTTTGAACAAACCCAATATTCCTCGAGGAATATTGGGTTTGTTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138367.1-2381s21c1
Sequence:CCGGATAGTTCAGATGACTACTAAACTCGAGTTTAGTAGTCATCTGAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138367.1-1164s21c1
Sequence:CCGGGTCGAAGCTCAACTCTTATTCCTCGAGGAATAAGAGTTGAGCTTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138367.1-609s21c1
Sequence:CCGGTTGTATCAAGAAGACTCTTAACTCGAGTTAAGAGTCTTCTTGATACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks