EMAIL THIS PAGE TO A FRIEND

ZNF253

zinc finger protein 253

Synonyms: BMZF-1 BMZF1 ZNF411
Species: Human ZNF253(56242)
UniProtKB ID: O75346, A4FVA7, Q0P6G3, Q6P0L2, Q8NCA3, Q8NCF9
Gene ID:
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021047 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021047 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021047 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021047 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021047 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157381 predicted 1306
2 SASI_Hs01_00157382 predicted 499
3 SASI_Hs01_00157383 predicted 1312
4 SASI_Hs01_00157384 predicted 341
5 SASI_Hs01_00157385 predicted 583
6 SASI_Hs01_00157386 predicted 501
7 SASI_Hs01_00157388 predicted 1651
8 SASI_Hs01_00157387 predicted 565
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021047
ZNF253 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 253
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021047.2-1672s21c1
Sequence:CCGGGAGTTTATATGGAACACAAACCTCGAGGTTTGTGTTCCATATAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021047.2-984s21c1
Sequence:CCGGCACGTTACCACACATAAGAAACTCGAGTTTCTTATGTGTGGTAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021047.1-184s1c1
Sequence:CCGGCCTTTAACTATGGAAAGACATCTCGAGATGTCTTTCCATAGTTAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021047.1-768s1c1
Sequence:CCGGCATAGTGAAGAATGTGACAGACTCGAGTCTGTCACATTCTTCACTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021047.1-222s1c1
Sequence:CCGGCCCAGTTATGAGTTCTCATTTCTCGAGAAATGAGAACTCATAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021047.1-584s1c1
Sequence:CCGGCTGGAGAGAAACCTTACAGATCTCGAGATCTGTAAGGTTTCTCTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021047.1-668s1c1
Sequence:CCGGCCGGAGAGAAACCTTACAAATCTCGAGATTTGTAAGGTTTCTCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021047
ZNF253 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 253
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021047.2-1672s21c1
Sequence:CCGGGAGTTTATATGGAACACAAACCTCGAGGTTTGTGTTCCATATAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021047.2-984s21c1
Sequence:CCGGCACGTTACCACACATAAGAAACTCGAGTTTCTTATGTGTGGTAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021047.1-184s1c1
Sequence:CCGGCCTTTAACTATGGAAAGACATCTCGAGATGTCTTTCCATAGTTAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021047.1-768s1c1
Sequence:CCGGCATAGTGAAGAATGTGACAGACTCGAGTCTGTCACATTCTTCACTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021047.1-222s1c1
Sequence:CCGGCCCAGTTATGAGTTCTCATTTCTCGAGAAATGAGAACTCATAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021047.1-584s1c1
Sequence:CCGGCTGGAGAGAAACCTTACAGATCTCGAGATCTGTAAGGTTTCTCTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021047.1-668s1c1
Sequence:CCGGCCGGAGAGAAACCTTACAAATCTCGAGATTTGTAAGGTTTCTCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021047
ZNF253 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 253
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021047.2-1672s21c1
Sequence:CCGGGAGTTTATATGGAACACAAACCTCGAGGTTTGTGTTCCATATAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021047.2-984s21c1
Sequence:CCGGCACGTTACCACACATAAGAAACTCGAGTTTCTTATGTGTGGTAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021047.1-184s1c1
Sequence:CCGGCCTTTAACTATGGAAAGACATCTCGAGATGTCTTTCCATAGTTAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021047.1-768s1c1
Sequence:CCGGCATAGTGAAGAATGTGACAGACTCGAGTCTGTCACATTCTTCACTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021047.1-222s1c1
Sequence:CCGGCCCAGTTATGAGTTCTCATTTCTCGAGAAATGAGAACTCATAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021047.1-584s1c1
Sequence:CCGGCTGGAGAGAAACCTTACAGATCTCGAGATCTGTAAGGTTTCTCTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021047.1-668s1c1
Sequence:CCGGCCGGAGAGAAACCTTACAAATCTCGAGATTTGTAAGGTTTCTCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks