EMAIL THIS PAGE TO A FRIEND

ZNF254

zinc finger protein 254

Synonyms: BMZF-5 HD-ZNF1 ZNF539 ZNF91L
Species: Human ZNF254(9534)
UniProtKB ID: O75437, A4QPC0, Q86XL7
Gene ID:
Human(9534) Summary: Zinc finger proteins have been shown to interact with nucleic acids and to have diverse functions. The zinc finger domain is a conserved amino acid sequence motif containing 2 specifically positioned cysteines and 2 histidines that are involved in coordinating zinc. Kruppel-related proteins form 1 family of zinc finger proteins. See ZFP93 (MIM 604749) for additional information on zinc finger proteins.[supplied by OMIM, Jul 2002]
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1411927 ANTI-ZNF254 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2102834 Anti-ZNF254 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203282 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203282 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203282 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_004876 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004876 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004876 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004876 Rosetta Predictions human pricing
NM_203282 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004876 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092476 predicted 1221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123751 predicted 2142
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203282
ZNF254 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 254
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203282.1-2049s1c1
Sequence:CCGGGCACCTCACCACAGATAAGATCTCGAGATCTTATCTGTGGTGAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203282.1-1572s1c1
Sequence:CCGGCACTGGAGAGAAACCCTACAACTCGAGTTGTAGGGTTTCTCTCCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203282.1-331s1c1
Sequence:CCGGCCCTGGAATATGAAGCGACATCTCGAGATGTCGCTTCATATTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203282.1-953s1c1
Sequence:CCGGCCTCAAATCTTACTACACATACTCGAGTATGTGTAGTAAGATTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203282.1-369s1c1
Sequence:CCGGCCCAGGTATGTGTCCTCATTTCTCGAGAAATGAGGACACATACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203282
ZNF254 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 254
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203282.1-2049s1c1
Sequence:CCGGGCACCTCACCACAGATAAGATCTCGAGATCTTATCTGTGGTGAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203282.1-1572s1c1
Sequence:CCGGCACTGGAGAGAAACCCTACAACTCGAGTTGTAGGGTTTCTCTCCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203282.1-331s1c1
Sequence:CCGGCCCTGGAATATGAAGCGACATCTCGAGATGTCGCTTCATATTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203282.1-953s1c1
Sequence:CCGGCCTCAAATCTTACTACACATACTCGAGTATGTGTAGTAAGATTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203282.1-369s1c1
Sequence:CCGGCCCAGGTATGTGTCCTCATTTCTCGAGAAATGAGGACACATACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203282
ZNF254 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 254
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203282.1-2049s1c1
Sequence:CCGGGCACCTCACCACAGATAAGATCTCGAGATCTTATCTGTGGTGAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203282.1-1572s1c1
Sequence:CCGGCACTGGAGAGAAACCCTACAACTCGAGTTGTAGGGTTTCTCTCCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203282.1-331s1c1
Sequence:CCGGCCCTGGAATATGAAGCGACATCTCGAGATGTCGCTTCATATTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203282.1-953s1c1
Sequence:CCGGCCTCAAATCTTACTACACATACTCGAGTATGTGTAGTAAGATTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203282.1-369s1c1
Sequence:CCGGCCCAGGTATGTGTCCTCATTTCTCGAGAAATGAGGACACATACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004876
VALIDATED
ZNF254 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 254
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004876.1-1380s1c1
Sequence:CCGGCACTTGATTGTAGGTAAGATACTCGAGTATCTTACCTACAATCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004876.1-889s1c1
Sequence:CCGGCCCTTACTACACATGAAATAACTCGAGTTATTTCATGTGTAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004876.1-1141s1c1
Sequence:CCGGACCTCACCACAGATAAGATAACTCGAGTTATCTTATCTGTGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004876.1-1147s1c1
Sequence:CCGGCCACAGATAAGATAACTCATACTCGAGTATGAGTTATCTTATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004876.1-1057s1c1
Sequence:CCGGCCCTAACTAAACATAAGAGAACTCGAGTTCTCTTATGTTTAGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004876
VALIDATED
ZNF254 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 254
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004876.1-1380s1c1
Sequence:CCGGCACTTGATTGTAGGTAAGATACTCGAGTATCTTACCTACAATCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004876.1-889s1c1
Sequence:CCGGCCCTTACTACACATGAAATAACTCGAGTTATTTCATGTGTAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004876.1-1141s1c1
Sequence:CCGGACCTCACCACAGATAAGATAACTCGAGTTATCTTATCTGTGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004876.1-1147s1c1
Sequence:CCGGCCACAGATAAGATAACTCATACTCGAGTATGAGTTATCTTATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004876.1-1057s1c1
Sequence:CCGGCCCTAACTAAACATAAGAGAACTCGAGTTCTCTTATGTTTAGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004876
VALIDATED
ZNF254 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 254
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004876.1-1380s1c1
Sequence:CCGGCACTTGATTGTAGGTAAGATACTCGAGTATCTTACCTACAATCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004876.1-889s1c1
Sequence:CCGGCCCTTACTACACATGAAATAACTCGAGTTATTTCATGTGTAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004876.1-1141s1c1
Sequence:CCGGACCTCACCACAGATAAGATAACTCGAGTTATCTTATCTGTGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004876.1-1147s1c1
Sequence:CCGGCCACAGATAAGATAACTCATACTCGAGTATGAGTTATCTTATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004876.1-1057s1c1
Sequence:CCGGCCCTAACTAAACATAAGAGAACTCGAGTTCTCTTATGTTTAGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks