EMAIL THIS PAGE TO A FRIEND

ZNF256

zinc finger protein 256

Synonyms: BMZF-3 BMZF3
UniProtKB ID: Q9Y2P7, B2RA92, Q53Y85, Q9BV71
Gene ID:
Horse(100061871) zinc finger protein 256
Horse(100061582) zinc finger protein 256
domestic cat(101091488) zinc finger protein 256
Domestic Rabbit(100352209) zinc finger protein 256
cow(790276) zinc finger protein 256
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005773 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005773 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005773 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU020451 MISSION® esiRNA esiRNA human ZNF256 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005773 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005773 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179835 predicted 1072
2 SASI_Hs02_00340252 predicted 1568
3 SASI_Hs01_00179836 predicted 1886
4 SASI_Hs02_00340253 predicted 1023
5 SASI_Hs01_00179837 predicted 291
6 SASI_Hs01_00179838 predicted 873
7 SASI_Hs01_00179839 predicted 1571
8 SASI_Hs01_00179840 predicted 1314
9 SASI_Hs01_00179842 predicted 941
10 SASI_Hs02_00340254 predicted 890
11 SASI_Hs01_00179841 predicted 1515
12 SASI_Hs01_00179843 predicted 601
13 SASI_Hs01_00179844 predicted 1353
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005773
ZNF256 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 256
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005773.2-1077s1c1
Sequence:CCGGGCCTTATTACGCACCGAAGAACTCGAGTTCTTCGGTGCGTAATAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005773.2-1905s1c1
Sequence:CCGGGTAACCACTCTAGCCTCGTTACTCGAGTAACGAGGCTAGAGTGGTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005773.2-705s1c1
Sequence:CCGGGCAGCTGCACATTTGAAGTATCTCGAGATACTTCAAATGTGCAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005773.2-599s1c1
Sequence:CCGGGCATGTAGGAAACAATTACAACTCGAGTTGTAATTGTTTCCTACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005773.2-989s21c1
Sequence:CCGGTGTAGCCTCAGTGATCATTTGCTCGAGCAAATGATCACTGAGGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005773.2-1908s21c1
Sequence:CCGGACCACTCTAGCCTCGTTAAACCTCGAGGTTTAACGAGGCTAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005773.2-1318s21c1
Sequence:CCGGCCATAGTTCTAGCCTTATTACCTCGAGGTAATAAGGCTAGAACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005773.2-1828s21c1
Sequence:CCGGCTCCAGCCTCATTAGACATAGCTCGAGCTATGTCTAATGAGGCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005773.2-1355s21c1
Sequence:CCGGACTGGTACAAGGCCTTATATGCTCGAGCATATAAGGCCTTGTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005773
ZNF256 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 256
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005773.2-1077s1c1
Sequence:CCGGGCCTTATTACGCACCGAAGAACTCGAGTTCTTCGGTGCGTAATAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005773.2-1905s1c1
Sequence:CCGGGTAACCACTCTAGCCTCGTTACTCGAGTAACGAGGCTAGAGTGGTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005773.2-705s1c1
Sequence:CCGGGCAGCTGCACATTTGAAGTATCTCGAGATACTTCAAATGTGCAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005773.2-599s1c1
Sequence:CCGGGCATGTAGGAAACAATTACAACTCGAGTTGTAATTGTTTCCTACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005773.2-989s21c1
Sequence:CCGGTGTAGCCTCAGTGATCATTTGCTCGAGCAAATGATCACTGAGGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005773.2-1908s21c1
Sequence:CCGGACCACTCTAGCCTCGTTAAACCTCGAGGTTTAACGAGGCTAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005773.2-1318s21c1
Sequence:CCGGCCATAGTTCTAGCCTTATTACCTCGAGGTAATAAGGCTAGAACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005773.2-1828s21c1
Sequence:CCGGCTCCAGCCTCATTAGACATAGCTCGAGCTATGTCTAATGAGGCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005773.2-1355s21c1
Sequence:CCGGACTGGTACAAGGCCTTATATGCTCGAGCATATAAGGCCTTGTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005773
ZNF256 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 256
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005773.2-1077s1c1
Sequence:CCGGGCCTTATTACGCACCGAAGAACTCGAGTTCTTCGGTGCGTAATAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005773.2-1905s1c1
Sequence:CCGGGTAACCACTCTAGCCTCGTTACTCGAGTAACGAGGCTAGAGTGGTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005773.2-705s1c1
Sequence:CCGGGCAGCTGCACATTTGAAGTATCTCGAGATACTTCAAATGTGCAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005773.2-599s1c1
Sequence:CCGGGCATGTAGGAAACAATTACAACTCGAGTTGTAATTGTTTCCTACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005773.2-989s21c1
Sequence:CCGGTGTAGCCTCAGTGATCATTTGCTCGAGCAAATGATCACTGAGGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005773.2-1908s21c1
Sequence:CCGGACCACTCTAGCCTCGTTAAACCTCGAGGTTTAACGAGGCTAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005773.2-1318s21c1
Sequence:CCGGCCATAGTTCTAGCCTTATTACCTCGAGGTAATAAGGCTAGAACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005773.2-1828s21c1
Sequence:CCGGCTCCAGCCTCATTAGACATAGCTCGAGCTATGTCTAATGAGGCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005773.2-1355s21c1
Sequence:CCGGACTGGTACAAGGCCTTATATGCTCGAGCATATAAGGCCTTGTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks