EMAIL THIS PAGE TO A FRIEND

ZNF257

zinc finger protein 257

Synonyms: BMZF-4 BMZF4
Species: Human ZNF257(113835)
UniProtKB ID: Q9Y2Q1, B3KPS4, E9PG34, Q8NE34
Gene ID:
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1408216 Anti-ZNF257 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2102836 Anti-ZNF257 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033468 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033468 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033468 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033468 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139938 predicted 1476
2 SASI_Hs01_00139941 predicted 1015
3 SASI_Hs01_00139939 predicted 1742
4 SASI_Hs01_00139942 predicted 1403
5 SASI_Hs02_00361346 predicted 1658
6 SASI_Hs01_00139945 predicted 1485
7 SASI_Hs02_00361347 predicted 1496
8 SASI_Hs02_00361348 predicted 975
9 SASI_Hs02_00361349 predicted 179
10 SASI_Hs02_00361350 predicted 175
11 SASI_Hs01_00139937 predicted 1565
12 SASI_Hs01_00139940 predicted 1210
13 SASI_Hs01_00139943 predicted 1582
14 SASI_Hs01_00139944 predicted 810
15 SASI_Hs01_00139946 predicted 1584
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033468
ZNF257 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 257
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033468.2-1995s21c1
Sequence:CCGGCTCAACATTTACTAAGCATAACTCGAGTTATGCTTAGTAAATGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033468.2-1018s21c1
Sequence:CCGGGCCCTTCAAATATGATGAATGCTCGAGCATTCATCATATTTGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033468.2-2275s21c1
Sequence:CCGGGCGAAACTACAATCCTGAATGCTCGAGCATTCAGGATTGTAGTTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033468.2-423s21c1
Sequence:CCGGTTTGCCCAGAGCGAGACATAACTCGAGTTATGTCTCGCTCTGGGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033468.2-2355s21c1
Sequence:CCGGAGTGCGAAACTCTAGAAATATCTCGAGATATTTCTAGAGTTTCGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033468.1-804s1c1
Sequence:CCGGCGGTCTTCACACATTACTCAACTCGAGTTGAGTAATGTGTGAAGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033468.1-308s1c1
Sequence:CCGGCCCAGTTATGTGTTCTCATATCTCGAGATATGAGAACACATAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033468.1-1506s1c1
Sequence:CCGGCCTTCTCAACATAGGATAATTCTCGAGAATTATCCTATGTTGAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033468.1-892s1c1
Sequence:CCGGCCTCAGCTCTTACTACCCTTACTCGAGTAAGGGTAGTAAGAGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033468.1-1583s1c1
Sequence:CCGGCTCATACCTTACCGTACATAACTCGAGTTATGTACGGTAAGGTATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033468
ZNF257 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 257
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033468.2-1995s21c1
Sequence:CCGGCTCAACATTTACTAAGCATAACTCGAGTTATGCTTAGTAAATGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033468.2-1018s21c1
Sequence:CCGGGCCCTTCAAATATGATGAATGCTCGAGCATTCATCATATTTGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033468.2-2275s21c1
Sequence:CCGGGCGAAACTACAATCCTGAATGCTCGAGCATTCAGGATTGTAGTTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033468.2-423s21c1
Sequence:CCGGTTTGCCCAGAGCGAGACATAACTCGAGTTATGTCTCGCTCTGGGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033468.2-2355s21c1
Sequence:CCGGAGTGCGAAACTCTAGAAATATCTCGAGATATTTCTAGAGTTTCGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033468.1-804s1c1
Sequence:CCGGCGGTCTTCACACATTACTCAACTCGAGTTGAGTAATGTGTGAAGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033468.1-308s1c1
Sequence:CCGGCCCAGTTATGTGTTCTCATATCTCGAGATATGAGAACACATAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033468.1-1506s1c1
Sequence:CCGGCCTTCTCAACATAGGATAATTCTCGAGAATTATCCTATGTTGAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033468.1-892s1c1
Sequence:CCGGCCTCAGCTCTTACTACCCTTACTCGAGTAAGGGTAGTAAGAGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033468.1-1583s1c1
Sequence:CCGGCTCATACCTTACCGTACATAACTCGAGTTATGTACGGTAAGGTATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033468
ZNF257 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 257
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033468.2-1995s21c1
Sequence:CCGGCTCAACATTTACTAAGCATAACTCGAGTTATGCTTAGTAAATGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033468.2-1018s21c1
Sequence:CCGGGCCCTTCAAATATGATGAATGCTCGAGCATTCATCATATTTGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033468.2-2275s21c1
Sequence:CCGGGCGAAACTACAATCCTGAATGCTCGAGCATTCAGGATTGTAGTTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033468.2-423s21c1
Sequence:CCGGTTTGCCCAGAGCGAGACATAACTCGAGTTATGTCTCGCTCTGGGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033468.2-2355s21c1
Sequence:CCGGAGTGCGAAACTCTAGAAATATCTCGAGATATTTCTAGAGTTTCGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033468.1-804s1c1
Sequence:CCGGCGGTCTTCACACATTACTCAACTCGAGTTGAGTAATGTGTGAAGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033468.1-308s1c1
Sequence:CCGGCCCAGTTATGTGTTCTCATATCTCGAGATATGAGAACACATAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033468.1-1506s1c1
Sequence:CCGGCCTTCTCAACATAGGATAATTCTCGAGAATTATCCTATGTTGAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033468.1-892s1c1
Sequence:CCGGCCTCAGCTCTTACTACCCTTACTCGAGTAAGGGTAGTAAGAGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033468.1-1583s1c1
Sequence:CCGGCTCATACCTTACCGTACATAACTCGAGTTATGTACGGTAAGGTATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks