EMAIL THIS PAGE TO A FRIEND

ZNF259

zinc finger protein 259

Synonyms: ZPR1
UniProtKB ID: O75312, Q2TAA0
Gene ID:
Zebrafish(406382) zinc finger protein 259
domestic cat(101085149) zinc finger protein 259
dog(479428) zinc finger protein 259
chicken(428256) zinc finger protein 259
cow(504523) zinc finger protein 259
sheep(101116504) zinc finger protein 259
Domestic Rabbit(100328795) zinc finger protein 259
naked mole-rat(101723755) zinc finger protein 259
domestic guinea pig(100729662) zinc finger protein 259
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003904 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003904 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003904 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111631 MISSION® esiRNA esiRNA human ZNF259 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003904 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003904 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223804 predicted 974
2 SASI_Hs01_00223806 predicted 726
3 SASI_Hs01_00223808 predicted 449
4 SASI_Hs01_00223809 predicted 333
5 SASI_Hs01_00223810 predicted 869
6 SASI_Hs01_00223811 predicted 831
7 SASI_Hs01_00223812 predicted 465
8 SASI_Hs02_00336531 predicted 403
9 SASI_Hs02_00336532 predicted 376
10 SASI_Hs01_00223807 predicted 1218
11 SASI_Hs01_00223803 predicted 1283
12 SASI_Hs01_00223805 predicted 1444
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003904
ZNF259 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 259
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003904.1-842s1c1
Sequence:CCGGCTAGTACAAATCCCTCACTTTCTCGAGAAAGTGAGGGATTTGTACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003904.1-1229s1c1
Sequence:CCGGGCCCACTTTATTATGGATGATCTCGAGATCATCCATAATAAAGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003904.1-1039s1c1
Sequence:CCGGGCTAGAATTTGAACTGGGAATCTCGAGATTCCCAGTTCAAATTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003904.1-242s1c1
Sequence:CCGGGAAATAATAGTGAGCTCCTTTCTCGAGAAAGGAGCTCACTATTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003904.1-1170s1c1
Sequence:CCGGCGGAGAGACTACAGGAGTTTACTCGAGTAAACTCCTGTAGTCTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003904.1-905s1c1
Sequence:CCGGCATCGGACCAATGAGGTGAAACTCGAGTTTCACCTCATTGGTCCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003904.3-1581s21c1
Sequence:CCGGTGATGCAAGTGTGAGCCTATTCTCGAGAATAGGCTCACACTTGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003904.3-1446s21c1
Sequence:CCGGTGCTCTTTCTGTAGGTTATTTCTCGAGAAATAACCTACAGAAAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003904.3-848s21c1
Sequence:CCGGTAGTACAAATCCCTCACTTTACTCGAGTAAAGTGAGGGATTTGTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003904.3-178s21c1
Sequence:CCGGTCGCTATGCATGAACTGTTACCTCGAGGTAACAGTTCATGCATAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003904.3-1553s21c1
Sequence:CCGGGATCTGTGCACACTTTCTAAACTCGAGTTTAGAAAGTGTGCACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003904
ZNF259 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 259
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003904.1-842s1c1
Sequence:CCGGCTAGTACAAATCCCTCACTTTCTCGAGAAAGTGAGGGATTTGTACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003904.1-1229s1c1
Sequence:CCGGGCCCACTTTATTATGGATGATCTCGAGATCATCCATAATAAAGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003904.1-1039s1c1
Sequence:CCGGGCTAGAATTTGAACTGGGAATCTCGAGATTCCCAGTTCAAATTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003904.1-242s1c1
Sequence:CCGGGAAATAATAGTGAGCTCCTTTCTCGAGAAAGGAGCTCACTATTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003904.1-1170s1c1
Sequence:CCGGCGGAGAGACTACAGGAGTTTACTCGAGTAAACTCCTGTAGTCTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003904.1-905s1c1
Sequence:CCGGCATCGGACCAATGAGGTGAAACTCGAGTTTCACCTCATTGGTCCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003904.3-1581s21c1
Sequence:CCGGTGATGCAAGTGTGAGCCTATTCTCGAGAATAGGCTCACACTTGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003904.3-1446s21c1
Sequence:CCGGTGCTCTTTCTGTAGGTTATTTCTCGAGAAATAACCTACAGAAAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003904.3-848s21c1
Sequence:CCGGTAGTACAAATCCCTCACTTTACTCGAGTAAAGTGAGGGATTTGTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003904.3-178s21c1
Sequence:CCGGTCGCTATGCATGAACTGTTACCTCGAGGTAACAGTTCATGCATAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003904.3-1553s21c1
Sequence:CCGGGATCTGTGCACACTTTCTAAACTCGAGTTTAGAAAGTGTGCACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003904
ZNF259 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 259
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003904.1-842s1c1
Sequence:CCGGCTAGTACAAATCCCTCACTTTCTCGAGAAAGTGAGGGATTTGTACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003904.1-1229s1c1
Sequence:CCGGGCCCACTTTATTATGGATGATCTCGAGATCATCCATAATAAAGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003904.1-1039s1c1
Sequence:CCGGGCTAGAATTTGAACTGGGAATCTCGAGATTCCCAGTTCAAATTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003904.1-242s1c1
Sequence:CCGGGAAATAATAGTGAGCTCCTTTCTCGAGAAAGGAGCTCACTATTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003904.1-1170s1c1
Sequence:CCGGCGGAGAGACTACAGGAGTTTACTCGAGTAAACTCCTGTAGTCTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003904.1-905s1c1
Sequence:CCGGCATCGGACCAATGAGGTGAAACTCGAGTTTCACCTCATTGGTCCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003904.3-1581s21c1
Sequence:CCGGTGATGCAAGTGTGAGCCTATTCTCGAGAATAGGCTCACACTTGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003904.3-1446s21c1
Sequence:CCGGTGCTCTTTCTGTAGGTTATTTCTCGAGAAATAACCTACAGAAAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003904.3-848s21c1
Sequence:CCGGTAGTACAAATCCCTCACTTTACTCGAGTAAAGTGAGGGATTTGTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003904.3-178s21c1
Sequence:CCGGTCGCTATGCATGAACTGTTACCTCGAGGTAACAGTTCATGCATAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003904.3-1553s21c1
Sequence:CCGGGATCTGTGCACACTTTCTAAACTCGAGTTTAGAAAGTGTGCACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks