EMAIL THIS PAGE TO A FRIEND

ZNF25

zinc finger protein 25

Synonyms: KOX19 Zfp9
UniProtKB ID: P17030, A9Z1X5, Q8IYE3, Q8NDD6, Q96MU2
Gene ID:
cow(101905074) zinc finger protein 25
cow(530225) zinc finger protein 25
domestic guinea pig(100730893) zinc finger protein 25
naked mole-rat(101715612) zinc finger protein 25
dog(479185) zinc finger protein 25
Horse(100056321) zinc finger protein 25
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV39841 Anti-ZNF25 antibody produced in rabbit IgG fraction of antiserum rat, horse, rabbit, mouse, human, bovine, canine
western blot pricing
HPA030190 Anti-ZNF25 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2103963 Anti-ZNF25 antibody produced in rabbit affinity isolated antibody bovine, human, rat, horse, rabbit, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145011 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145011 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145011 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU050631 MISSION® esiRNA esiRNA human ZNF25 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145011 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145011 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217233 predicted 518
2 SASI_Hs01_00217234 predicted 652
3 SASI_Hs01_00217236 predicted 1211
4 SASI_Hs02_00364856 predicted 654
5 SASI_Hs01_00217237 predicted 1527
6 SASI_Hs02_00364857 predicted 1527
7 SASI_Hs01_00217238 predicted 346
8 SASI_Hs01_00217239 predicted 974
9 SASI_Hs02_00364858 predicted 355
10 SASI_Hs01_00217240 predicted 1059
11 SASI_Hs01_00217235 predicted 1472
12 SASI_Hs01_00217241 predicted 499
13 SASI_Hs01_00217242 predicted 1249
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145011
ZNF25 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 25
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145011.2-1872s21c1
Sequence:CCGGGAGTATCTAGAAATCTCTTTACTCGAGTAAAGAGATTTCTAGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145011.2-1546s21c1
Sequence:CCGGACCTTATGAATCGCATCAATACTCGAGTATTGATGCGATTCATAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145011.2-500s1c1
Sequence:CCGGCCCTCATAGTACATCAGCATACTCGAGTATGCTGATGTACTATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145011.2-1220s1c1
Sequence:CCGGGCACAGAATGTGGCAAATCTTCTCGAGAAGATTTGCCACATTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145011.2-1444s1c1
Sequence:CCGGACACACACAAAGAAGAGGAATCTCGAGATTCCTCTTCTTTGTGTGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145011.2-340s1c1
Sequence:CCGGCCTGAAGACCTATGGAGCATTCTCGAGAATGCTCCATAGGTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145011.2-271s1c1
Sequence:CCGGGCAGTCTTCAAGTTGAAGCAACTCGAGTTGCTTCAACTTGAAGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145011
ZNF25 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 25
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145011.2-1872s21c1
Sequence:CCGGGAGTATCTAGAAATCTCTTTACTCGAGTAAAGAGATTTCTAGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145011.2-1546s21c1
Sequence:CCGGACCTTATGAATCGCATCAATACTCGAGTATTGATGCGATTCATAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145011.2-500s1c1
Sequence:CCGGCCCTCATAGTACATCAGCATACTCGAGTATGCTGATGTACTATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145011.2-1220s1c1
Sequence:CCGGGCACAGAATGTGGCAAATCTTCTCGAGAAGATTTGCCACATTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145011.2-1444s1c1
Sequence:CCGGACACACACAAAGAAGAGGAATCTCGAGATTCCTCTTCTTTGTGTGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145011.2-340s1c1
Sequence:CCGGCCTGAAGACCTATGGAGCATTCTCGAGAATGCTCCATAGGTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145011.2-271s1c1
Sequence:CCGGGCAGTCTTCAAGTTGAAGCAACTCGAGTTGCTTCAACTTGAAGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145011
ZNF25 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 25
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145011.2-1872s21c1
Sequence:CCGGGAGTATCTAGAAATCTCTTTACTCGAGTAAAGAGATTTCTAGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145011.2-1546s21c1
Sequence:CCGGACCTTATGAATCGCATCAATACTCGAGTATTGATGCGATTCATAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145011.2-500s1c1
Sequence:CCGGCCCTCATAGTACATCAGCATACTCGAGTATGCTGATGTACTATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145011.2-1220s1c1
Sequence:CCGGGCACAGAATGTGGCAAATCTTCTCGAGAAGATTTGCCACATTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145011.2-1444s1c1
Sequence:CCGGACACACACAAAGAAGAGGAATCTCGAGATTCCTCTTCTTTGTGTGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145011.2-340s1c1
Sequence:CCGGCCTGAAGACCTATGGAGCATTCTCGAGAATGCTCCATAGGTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145011.2-271s1c1
Sequence:CCGGGCAGTCTTCAAGTTGAAGCAACTCGAGTTGCTTCAACTTGAAGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks