EMAIL THIS PAGE TO A FRIEND

ZNF260

zinc finger protein 260

Synonyms: OZRF1 PEX1 ZFP260
UniProtKB ID: Q3ZCT1, Q0VF43
Gene ID:
cow(790879) zinc finger protein 260
naked mole-rat(101718503) zinc finger protein 260
domestic guinea pig(100730443) zinc finger protein 260
domestic cat(101095298) zinc finger protein 260
dog(484560) zinc finger protein 260
11 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA028806 Anti-ZNF260 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012756 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012756 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012756 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012756 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226165 predicted 1069
2 SASI_Hs01_00226166 predicted 1697
3 SASI_Hs01_00226167 predicted 1193
4 SASI_Hs01_00226168 predicted 1363
5 SASI_Hs01_00226169 predicted 997
6 SASI_Hs01_00226170 predicted 878
7 SASI_Hs01_00226171 predicted 1861
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012756
VALIDATED
ZNF260 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 260
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001012756.1-1274s1c1
Sequence:CCGGGCCTTTAACGGCAAAGCATATCTCGAGATATGCTTTGCCGTTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012756.1-5154s1c1
Sequence:CCGGCCAGAATAACTAGGACTCAAACTCGAGTTTGAGTCCTAGTTATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012756.1-1702s1c1
Sequence:CCGGGCAGAAGCAATACCTCATTAACTCGAGTTAATGAGGTATTGCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012756.1-1366s1c1
Sequence:CCGGCCAGAAGCAATACCTCATTAACTCGAGTTAATGAGGTATTGCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012756.1-1040s1c1
Sequence:CCGGCGAGTCTCATCTCTTACTCTACTCGAGTAGAGTAAGAGATGAGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001012756.1-1904s1c1
Sequence:CCGGCATACAGGTGAGAAACCCTATCTCGAGATAGGGTTTCTCACCTGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001012756.1-1253s1c1
Sequence:CCGGGCATGTAAGGAATGTGGCAAACTCGAGTTTGCCACATTCCTTACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001012756.1-1875s1c1
Sequence:CCGGGCTCATCTCTTACTGTGCATACTCGAGTATGCACAGTAAGAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012756.1-875s1c1
Sequence:CCGGGAATCAGATCTCCTTCAGCATCTCGAGATGCTGAAGGAGATCTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012756
VALIDATED
ZNF260 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 260
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001012756.1-1274s1c1
Sequence:CCGGGCCTTTAACGGCAAAGCATATCTCGAGATATGCTTTGCCGTTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012756.1-5154s1c1
Sequence:CCGGCCAGAATAACTAGGACTCAAACTCGAGTTTGAGTCCTAGTTATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012756.1-1702s1c1
Sequence:CCGGGCAGAAGCAATACCTCATTAACTCGAGTTAATGAGGTATTGCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012756.1-1366s1c1
Sequence:CCGGCCAGAAGCAATACCTCATTAACTCGAGTTAATGAGGTATTGCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012756.1-1040s1c1
Sequence:CCGGCGAGTCTCATCTCTTACTCTACTCGAGTAGAGTAAGAGATGAGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001012756.1-1904s1c1
Sequence:CCGGCATACAGGTGAGAAACCCTATCTCGAGATAGGGTTTCTCACCTGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001012756.1-1253s1c1
Sequence:CCGGGCATGTAAGGAATGTGGCAAACTCGAGTTTGCCACATTCCTTACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001012756.1-1875s1c1
Sequence:CCGGGCTCATCTCTTACTGTGCATACTCGAGTATGCACAGTAAGAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012756.1-875s1c1
Sequence:CCGGGAATCAGATCTCCTTCAGCATCTCGAGATGCTGAAGGAGATCTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012756
VALIDATED
ZNF260 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 260
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001012756.1-1274s1c1
Sequence:CCGGGCCTTTAACGGCAAAGCATATCTCGAGATATGCTTTGCCGTTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012756.1-5154s1c1
Sequence:CCGGCCAGAATAACTAGGACTCAAACTCGAGTTTGAGTCCTAGTTATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012756.1-1702s1c1
Sequence:CCGGGCAGAAGCAATACCTCATTAACTCGAGTTAATGAGGTATTGCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012756.1-1366s1c1
Sequence:CCGGCCAGAAGCAATACCTCATTAACTCGAGTTAATGAGGTATTGCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012756.1-1040s1c1
Sequence:CCGGCGAGTCTCATCTCTTACTCTACTCGAGTAGAGTAAGAGATGAGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001012756.1-1904s1c1
Sequence:CCGGCATACAGGTGAGAAACCCTATCTCGAGATAGGGTTTCTCACCTGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001012756.1-1253s1c1
Sequence:CCGGGCATGTAAGGAATGTGGCAAACTCGAGTTTGCCACATTCCTTACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001012756.1-1875s1c1
Sequence:CCGGGCTCATCTCTTACTGTGCATACTCGAGTATGCACAGTAAGAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012756.1-875s1c1
Sequence:CCGGGAATCAGATCTCCTTCAGCATCTCGAGATGCTGAAGGAGATCTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks