EMAIL THIS PAGE TO A FRIEND

ZNF263

zinc finger protein 263

Synonyms: FPM315 ZKSCAN12 ZSCAN44
UniProtKB ID: O14978, B2R634, O43387, Q96H95
Gene ID:
Horse(100069327) zinc finger protein 263
dog(490040) zinc finger protein 263
domestic cat(101098424) zinc finger protein 263
domestic guinea pig(100717044) zinc finger protein 263
naked mole-rat(101703566) zinc finger protein 263
cow(100138099) zinc finger protein 263
sheep(101119524) zinc finger protein 263
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102837 Anti-ZNF263 (ab1) antibody produced in rabbit affinity isolated antibody mouse, guinea pig, human, rat, horse, rabbit
western blot pricing
SAB2102838 Anti-ZNF263 (ab2) antibody produced in rabbit affinity isolated antibody canine, bovine, pig, human, rabbit, rat, guinea pig, horse, mouse
western blot pricing
SAB1406927 Anti-ZNF263 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1412388 ANTI-ZNF263 antibody produced in mouse clone 2A1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412623 ANTI-ZNF263 antibody produced in mouse clone 2G6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412641 ANTI-ZNF263 antibody produced in mouse clone 2E9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA035086 Anti-ZNF263 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA035085 Anti-ZNF263 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
WH0010127M1 Monoclonal Anti-ZNF263 antibody produced in mouse clone 6G7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404787 Monoclonal Anti-ZNF263 antibody produced in mouse clone 1F9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005741 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005741 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005741 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004341 MISSION® esiRNA esiRNA targeting human ZNF263 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005741 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005741 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116180 predicted 1578
2 SASI_Hs01_00116181 predicted 1481
3 SASI_Hs01_00116182 predicted 786
4 SASI_Hs02_00340182 predicted 2164
5 SASI_Hs01_00116183 predicted 1826
6 SASI_Hs01_00116184 predicted 1935
7 SASI_Hs01_00116186 predicted 1102
8 SASI_Hs01_00116187 predicted 1918
9 SASI_Hs01_00116188 predicted 1535
10 SASI_Hs01_00116189 predicted 980
11 SASI_Hs01_00116185 predicted 2059
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005741
VALIDATED
ZNF263 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 263
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005741.3-2466s1c1
Sequence:CCGGCGACCAAATGACCTCTGCATTCTCGAGAATGCAGAGGTCATTTGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005741.3-883s1c1
Sequence:CCGGGCTGTAAAGGAGAGGGCATTACTCGAGTAATGCCCTCTCCTTTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005741.3-704s1c1
Sequence:CCGGGACTGAGACAACAGGTCACAACTCGAGTTGTGACCTGTTGTCTCAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005741.3-1925s1c1
Sequence:CCGGACCTCGTCATTCACGAAAGAACTCGAGTTCTTTCGTGAATGACGAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005741.3-1446s1c1
Sequence:CCGGGCAGCCAAAGAAACTCCATTTCTCGAGAAATGGAGTTTCTTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005741.4-1448s21c1
Sequence:CCGGGCAGCCAAAGAAACTCCATTTCTCGAGAAATGGAGTTTCTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005741.4-2528s21c1
Sequence:CCGGGCAGCAGAGGATTGGCATAAACTCGAGTTTATGCCAATCCTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005741.4-706s21c1
Sequence:CCGGGACTGAGACAACAGGTCACAACTCGAGTTGTGACCTGTTGTCTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005741.4-885s21c1
Sequence:CCGGGCTGTAAAGGAGAGGGCATTACTCGAGTAATGCCCTCTCCTTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005741.4-2167s21c1
Sequence:CCGGTCTCTCATAGATCCAATTTAACTCGAGTTAAATTGGATCTATGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005741
VALIDATED
ZNF263 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 263
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005741.3-2466s1c1
Sequence:CCGGCGACCAAATGACCTCTGCATTCTCGAGAATGCAGAGGTCATTTGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005741.3-883s1c1
Sequence:CCGGGCTGTAAAGGAGAGGGCATTACTCGAGTAATGCCCTCTCCTTTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005741.3-704s1c1
Sequence:CCGGGACTGAGACAACAGGTCACAACTCGAGTTGTGACCTGTTGTCTCAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005741.3-1925s1c1
Sequence:CCGGACCTCGTCATTCACGAAAGAACTCGAGTTCTTTCGTGAATGACGAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005741.3-1446s1c1
Sequence:CCGGGCAGCCAAAGAAACTCCATTTCTCGAGAAATGGAGTTTCTTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005741.4-1448s21c1
Sequence:CCGGGCAGCCAAAGAAACTCCATTTCTCGAGAAATGGAGTTTCTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005741.4-2528s21c1
Sequence:CCGGGCAGCAGAGGATTGGCATAAACTCGAGTTTATGCCAATCCTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005741.4-706s21c1
Sequence:CCGGGACTGAGACAACAGGTCACAACTCGAGTTGTGACCTGTTGTCTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005741.4-885s21c1
Sequence:CCGGGCTGTAAAGGAGAGGGCATTACTCGAGTAATGCCCTCTCCTTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005741.4-2167s21c1
Sequence:CCGGTCTCTCATAGATCCAATTTAACTCGAGTTAAATTGGATCTATGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005741
VALIDATED
ZNF263 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 263
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005741.3-2466s1c1
Sequence:CCGGCGACCAAATGACCTCTGCATTCTCGAGAATGCAGAGGTCATTTGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005741.3-883s1c1
Sequence:CCGGGCTGTAAAGGAGAGGGCATTACTCGAGTAATGCCCTCTCCTTTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005741.3-704s1c1
Sequence:CCGGGACTGAGACAACAGGTCACAACTCGAGTTGTGACCTGTTGTCTCAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005741.3-1925s1c1
Sequence:CCGGACCTCGTCATTCACGAAAGAACTCGAGTTCTTTCGTGAATGACGAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005741.3-1446s1c1
Sequence:CCGGGCAGCCAAAGAAACTCCATTTCTCGAGAAATGGAGTTTCTTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005741.4-1448s21c1
Sequence:CCGGGCAGCCAAAGAAACTCCATTTCTCGAGAAATGGAGTTTCTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005741.4-2528s21c1
Sequence:CCGGGCAGCAGAGGATTGGCATAAACTCGAGTTTATGCCAATCCTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005741.4-706s21c1
Sequence:CCGGGACTGAGACAACAGGTCACAACTCGAGTTGTGACCTGTTGTCTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005741.4-885s21c1
Sequence:CCGGGCTGTAAAGGAGAGGGCATTACTCGAGTAATGCCCTCTCCTTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005741.4-2167s21c1
Sequence:CCGGTCTCTCATAGATCCAATTTAACTCGAGTTAAATTGGATCTATGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks