EMAIL THIS PAGE TO A FRIEND

ZNF264

zinc finger protein 264

Species: Human ZNF264(9422), naked mole-rat Znf264(101716825), Domestic Rabbit ZNF264(100338781), domestic guinea pig Znf264(100717600), Horse ZNF264(100059529), domestic cat ZNF264(101099850)
UniProtKB ID: O43296, A8K8Y9, Q9P1V0
Gene ID:
Human(9422) Summary: This gene encodes a zinc finger protein and belongs to the krueppel C2H2-type zinc-finger protein family. Zinc finger proteins are often localized in the nucleus, bind nucleic acids, and regulate transcription. [provided by RefSeq, Jan 2010]
naked mole-rat(101716825) zinc finger protein 264
Domestic Rabbit(100338781) zinc finger protein 264
domestic guinea pig(100717600) zinc finger protein 264
Horse(100059529) zinc finger protein 264
domestic cat(101099850) zinc finger protein 264
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV38320 Anti-ZNF264 antibody produced in rabbit affinity isolated antibody bovine, rabbit, human, horse
western blot pricing
SAB2102839 Anti-ZNF264 antibody produced in rabbit affinity isolated antibody rat, canine, bovine, mouse, horse, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003417 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003417 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003417 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_375660 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_375660 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_375660 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102761 MISSION® esiRNA esiRNA human ZNF805 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003417 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014223 predicted 1142
2 SASI_Hs01_00014225 predicted 961
3 SASI_Hs01_00014226 predicted 715
4 SASI_Hs02_00335625 predicted 688
5 SASI_Hs01_00014227 predicted 2325
6 SASI_Hs01_00014228 predicted 943
7 SASI_Hs01_00014229 predicted 2330
8 SASI_Hs01_00014230 predicted 729
9 SASI_Hs01_00014231 predicted 1993
10 SASI_Hs01_00014232 predicted 928
11 SASI_Hs01_00014224 predicted 2236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003417
ZNF264 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 264
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003417.3-951s21c1
Sequence:CCGGGATAGAGTCCGTAGCCATAACCTCGAGGTTATGGCTACGGACTCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003417.3-1988s21c1
Sequence:CCGGCCTCATTCGACATGCCATTATCTCGAGATAATGGCATGTCGAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003417.3-2326s21c1
Sequence:CCGGGTCATCTGAAGAGTCATATTACTCGAGTAATATGACTCTTCAGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003417.3-2202s21c1
Sequence:CCGGGTAACCACTGAGGCAAATATTCTCGAGAATATTTGCCTCAGTGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003417.3-1373s21c1
Sequence:CCGGTGGCCAAGTCTTTCGACATAGCTCGAGCTATGTCGAAAGACTTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003417
ZNF264 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 264
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003417.3-951s21c1
Sequence:CCGGGATAGAGTCCGTAGCCATAACCTCGAGGTTATGGCTACGGACTCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003417.3-1988s21c1
Sequence:CCGGCCTCATTCGACATGCCATTATCTCGAGATAATGGCATGTCGAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003417.3-2326s21c1
Sequence:CCGGGTCATCTGAAGAGTCATATTACTCGAGTAATATGACTCTTCAGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003417.3-2202s21c1
Sequence:CCGGGTAACCACTGAGGCAAATATTCTCGAGAATATTTGCCTCAGTGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003417.3-1373s21c1
Sequence:CCGGTGGCCAAGTCTTTCGACATAGCTCGAGCTATGTCGAAAGACTTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003417
ZNF264 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 264
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003417.3-951s21c1
Sequence:CCGGGATAGAGTCCGTAGCCATAACCTCGAGGTTATGGCTACGGACTCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003417.3-1988s21c1
Sequence:CCGGCCTCATTCGACATGCCATTATCTCGAGATAATGGCATGTCGAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003417.3-2326s21c1
Sequence:CCGGGTCATCTGAAGAGTCATATTACTCGAGTAATATGACTCTTCAGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003417.3-2202s21c1
Sequence:CCGGGTAACCACTGAGGCAAATATTCTCGAGAATATTTGCCTCAGTGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003417.3-1373s21c1
Sequence:CCGGTGGCCAAGTCTTTCGACATAGCTCGAGCTATGTCGAAAGACTTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_375660
VALIDATED
ZNF264 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 264
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:XM_375660.1-1395s1c1
Sequence:CCGGCCAGGCTTTCTCCGGCACTATCTCGAGATAGTGCCGGAGAAAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:XM_375660.1-981s1c1
Sequence:CCGGTCAGGTAAAGATCCCATGATTCTCGAGAATCATGGGATCTTTACCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375660.1-875s1c1
Sequence:CCGGGAGCCCTGAATGTGATGGTTTCTCGAGAAACCATCACATTCAGGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:XM_375660.1-1987s1c1
Sequence:CCGGACCTCATTCGACATGCCATTACTCGAGTAATGGCATGTCGAATGAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:XM_375660.1-2242s1c1
Sequence:CCGGCCTCTGCATCTGATCAACCATCTCGAGATGGTTGATCAGATGCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_375660
VALIDATED
ZNF264 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 264
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:XM_375660.1-1395s1c1
Sequence:CCGGCCAGGCTTTCTCCGGCACTATCTCGAGATAGTGCCGGAGAAAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:XM_375660.1-981s1c1
Sequence:CCGGTCAGGTAAAGATCCCATGATTCTCGAGAATCATGGGATCTTTACCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375660.1-875s1c1
Sequence:CCGGGAGCCCTGAATGTGATGGTTTCTCGAGAAACCATCACATTCAGGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:XM_375660.1-1987s1c1
Sequence:CCGGACCTCATTCGACATGCCATTACTCGAGTAATGGCATGTCGAATGAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:XM_375660.1-2242s1c1
Sequence:CCGGCCTCTGCATCTGATCAACCATCTCGAGATGGTTGATCAGATGCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_375660
VALIDATED
ZNF264 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 264
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:XM_375660.1-1395s1c1
Sequence:CCGGCCAGGCTTTCTCCGGCACTATCTCGAGATAGTGCCGGAGAAAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:XM_375660.1-981s1c1
Sequence:CCGGTCAGGTAAAGATCCCATGATTCTCGAGAATCATGGGATCTTTACCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375660.1-875s1c1
Sequence:CCGGGAGCCCTGAATGTGATGGTTTCTCGAGAAACCATCACATTCAGGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:XM_375660.1-1987s1c1
Sequence:CCGGACCTCATTCGACATGCCATTACTCGAGTAATGGCATGTCGAATGAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:XM_375660.1-2242s1c1
Sequence:CCGGCCTCTGCATCTGATCAACCATCTCGAGATGGTTGATCAGATGCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks