EMAIL THIS PAGE TO A FRIEND

ZNF266

zinc finger protein 266

Synonyms: HZF1
Species: Human ZNF266(10781), domestic guinea pig Znf266(101787161), Domestic Rabbit ZNF266(100349966), cow ZNF266(509250)
Gene ID:
Human(10781) Summary: This gene encodes a protein containing many tandem zinc-finger motifs. Zinc fingers are protein or nucleic acid-binding domains, and may be involved in a variety of functions, including regulation of transcription. This gene is located in a cluster of similar genes encoding zinc finger proteins on chromosome 19. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Sep 2012]
domestic guinea pig(101787161) zinc finger protein 266
Domestic Rabbit(100349966) zinc finger protein 266
cow(509250) zinc finger protein 266
36 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1407050 Anti-ZNF266 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
AV35808 Anti-ZNF266 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB1401536 Anti-ZNF266 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2104471 Anti-ZNF266 antibody produced in rabbit affinity isolated antibody guinea pig, human, mouse, rabbit
western blot pricing
HPA026836 Anti-ZNF266 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA054110 Anti-ZNF266 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2102997 Anti-ZNF266, (N-terminal) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB1401537 Monoclonal Anti-ZNF266 antibody produced in mouse clone 1B9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404868 Monoclonal Anti-ZNF266 antibody produced in mouse clone 4G5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006631 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006631 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006631 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006631 Rosetta Predictions human pricing
NM_198058 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020142 predicted 1749
2 SASI_Hs01_00020143 predicted 2605
3 SASI_Hs01_00020144 predicted 2781
4 SASI_Hs01_00020146 predicted 2178
5 SASI_Hs01_00020147 predicted 1579
6 SASI_Hs01_00020148 predicted 2588
7 SASI_Hs01_00020149 predicted 1650
8 SASI_Hs01_00020150 predicted 1590
9 SASI_Hs01_00020151 predicted 1795
10 SASI_Hs02_00341979 predicted 2019
11 SASI_Hs01_00020145 predicted 2200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198058 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158096 predicted 1470
2 SASI_Hs01_00158097 predicted 2327
3 SASI_Hs01_00158098 predicted 2500
4 SASI_Hs01_00158100 predicted 1903
5 SASI_Hs01_00158101 predicted 1294
6 SASI_Hs01_00158102 predicted 2310
7 SASI_Hs01_00158103 predicted 1373
8 SASI_Hs01_00158104 predicted 1310
9 SASI_Hs01_00158105 predicted 1516
10 SASI_Hs02_00371616 predicted 1736
11 SASI_Hs01_00158099 predicted 1921
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006631
ZNF266 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 266
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006631.2-3109s1c1
Sequence:CCGGGCCTTACCAAACACATCAGAACTCGAGTTCTGATGTGTTTGGTAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006631.2-2446s1c1
Sequence:CCGGCCTCTCGCCTTAGTGAACATACTCGAGTATGTTCACTAAGGCGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006631.2-1816s1c1
Sequence:CCGGGTCTCCATGAATGGAAGGAATCTCGAGATTCCTTCCATTCATGGAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006631.2-1392s1c1
Sequence:CCGGGAATGGAAAGTGCAACTTAAACTCGAGTTTAAGTTGCACTTTCCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006631.2-2584s1c1
Sequence:CCGGGCCTGGAATGTGGTAAAGCATCTCGAGATGCTTTACCACATTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006631.2-1860s21c1
Sequence:CCGGACAGACCTTGCTGTGCGTATACTCGAGTATACGCACAGCAAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006631.2-2018s21c1
Sequence:CCGGCACCAGGTCTTGTCAACTTACCTCGAGGTAAGTTGACAAGACCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006631.2-2606s21c1
Sequence:CCGGTACGCATTCCTCCAGTCTTAACTCGAGTTAAGACTGGAGGAATGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006631.2-3292s21c1
Sequence:CCGGCCTAGTTCCTTACACTATAACCTCGAGGTTATAGTGTAAGGAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006631.2-1391s21c1
Sequence:GTACCGGAGAATGGAAAGTGCAACTTAACTCGAGTTAAGTTGCACTTTCCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006631
ZNF266 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 266
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006631.2-3109s1c1
Sequence:CCGGGCCTTACCAAACACATCAGAACTCGAGTTCTGATGTGTTTGGTAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006631.2-2446s1c1
Sequence:CCGGCCTCTCGCCTTAGTGAACATACTCGAGTATGTTCACTAAGGCGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006631.2-1816s1c1
Sequence:CCGGGTCTCCATGAATGGAAGGAATCTCGAGATTCCTTCCATTCATGGAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006631.2-1392s1c1
Sequence:CCGGGAATGGAAAGTGCAACTTAAACTCGAGTTTAAGTTGCACTTTCCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006631.2-2584s1c1
Sequence:CCGGGCCTGGAATGTGGTAAAGCATCTCGAGATGCTTTACCACATTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006631.2-1860s21c1
Sequence:CCGGACAGACCTTGCTGTGCGTATACTCGAGTATACGCACAGCAAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006631.2-2018s21c1
Sequence:CCGGCACCAGGTCTTGTCAACTTACCTCGAGGTAAGTTGACAAGACCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006631.2-2606s21c1
Sequence:CCGGTACGCATTCCTCCAGTCTTAACTCGAGTTAAGACTGGAGGAATGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006631.2-3292s21c1
Sequence:CCGGCCTAGTTCCTTACACTATAACCTCGAGGTTATAGTGTAAGGAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006631.2-1391s21c1
Sequence:GTACCGGAGAATGGAAAGTGCAACTTAACTCGAGTTAAGTTGCACTTTCCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006631
ZNF266 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 266
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006631.2-3109s1c1
Sequence:CCGGGCCTTACCAAACACATCAGAACTCGAGTTCTGATGTGTTTGGTAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006631.2-2446s1c1
Sequence:CCGGCCTCTCGCCTTAGTGAACATACTCGAGTATGTTCACTAAGGCGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006631.2-1816s1c1
Sequence:CCGGGTCTCCATGAATGGAAGGAATCTCGAGATTCCTTCCATTCATGGAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006631.2-1392s1c1
Sequence:CCGGGAATGGAAAGTGCAACTTAAACTCGAGTTTAAGTTGCACTTTCCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006631.2-2584s1c1
Sequence:CCGGGCCTGGAATGTGGTAAAGCATCTCGAGATGCTTTACCACATTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006631.2-1860s21c1
Sequence:CCGGACAGACCTTGCTGTGCGTATACTCGAGTATACGCACAGCAAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006631.2-2018s21c1
Sequence:CCGGCACCAGGTCTTGTCAACTTACCTCGAGGTAAGTTGACAAGACCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006631.2-2606s21c1
Sequence:CCGGTACGCATTCCTCCAGTCTTAACTCGAGTTAAGACTGGAGGAATGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006631.2-3292s21c1
Sequence:CCGGCCTAGTTCCTTACACTATAACCTCGAGGTTATAGTGTAAGGAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006631.2-1391s21c1
Sequence:GTACCGGAGAATGGAAAGTGCAACTTAACTCGAGTTAAGTTGCACTTTCCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks