EMAIL THIS PAGE TO A FRIEND

ZNF267

zinc finger protein 267

Synonyms: HZF2
Species: Human ZNF267(10308)
UniProtKB ID: Q14586, A0JNZ9, Q8NE41, Q9NRJ0
Gene ID:
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003414 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003414 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003414 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003414 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122010 predicted 1065
2 SASI_Hs01_00122011 predicted 208
3 SASI_Hs01_00122012 predicted 2222
4 SASI_Hs01_00122015 predicted 579
5 SASI_Hs01_00122016 predicted 1195
6 SASI_Hs01_00122017 predicted 707
7 SASI_Hs02_00335614 predicted 431
8 SASI_Hs01_00122018 predicted 737
9 SASI_Hs01_00122019 predicted 954
10 SASI_Hs02_00335615 predicted 567
11 SASI_Hs01_00122013 predicted 1023
12 SASI_Hs01_00122014 predicted 499
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003414
VALIDATED
ZNF267 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 267
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003414.4-697s21c1
Sequence:CCGGATCAATATAGGAAGGTCTTTACTCGAGTAAAGACCTTCCTATATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003414.4-1376s21c1
Sequence:CCGGTACTCGTTCCTCCAATCTTATCTCGAGATAAGATTGGAGGAACGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003414.4-800s21c1
Sequence:CCGGTAGGCAGGTCTCTACTCTAAACTCGAGTTTAGAGTAGAGACCTGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003414.4-1194s21c1
Sequence:CCGGGATAGCTTAAACCATAGTTTGCTCGAGCAAACTATGGTTTAAGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003414.4-2757s21c1
Sequence:CCGGGAAGTTTGCAGATGCAATAAACTCGAGTTTATTGCATCTGCAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003414.3-2490s1c1
Sequence:CCGGCCTTACACAATAGCAGAGAATCTCGAGATTCTCTGCTATTGTGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_003414.3-1553s1c1
Sequence:CCGGGCTCGTTCTTCAAATCTTATTCTCGAGAATAAGATTTGAAGAACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003414.3-735s1c1
Sequence:CCGGCTACTCTAAATAGTTACCGAACTCGAGTTCGGTAACTATTTAGAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003414.3-200s1c1
Sequence:CCGGCCAGCTCAGAAGAATTTGTATCTCGAGATACAAATTCTTCTGAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003414.3-1794s1c1
Sequence:CCGGGCAAAGCCTTTCCTTATAGTTCTCGAGAACTATAAGGAAAGGCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003414
VALIDATED
ZNF267 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 267
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003414.4-697s21c1
Sequence:CCGGATCAATATAGGAAGGTCTTTACTCGAGTAAAGACCTTCCTATATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003414.4-1376s21c1
Sequence:CCGGTACTCGTTCCTCCAATCTTATCTCGAGATAAGATTGGAGGAACGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003414.4-800s21c1
Sequence:CCGGTAGGCAGGTCTCTACTCTAAACTCGAGTTTAGAGTAGAGACCTGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003414.4-1194s21c1
Sequence:CCGGGATAGCTTAAACCATAGTTTGCTCGAGCAAACTATGGTTTAAGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003414.4-2757s21c1
Sequence:CCGGGAAGTTTGCAGATGCAATAAACTCGAGTTTATTGCATCTGCAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003414.3-2490s1c1
Sequence:CCGGCCTTACACAATAGCAGAGAATCTCGAGATTCTCTGCTATTGTGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_003414.3-1553s1c1
Sequence:CCGGGCTCGTTCTTCAAATCTTATTCTCGAGAATAAGATTTGAAGAACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003414.3-735s1c1
Sequence:CCGGCTACTCTAAATAGTTACCGAACTCGAGTTCGGTAACTATTTAGAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003414.3-200s1c1
Sequence:CCGGCCAGCTCAGAAGAATTTGTATCTCGAGATACAAATTCTTCTGAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003414.3-1794s1c1
Sequence:CCGGGCAAAGCCTTTCCTTATAGTTCTCGAGAACTATAAGGAAAGGCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003414
VALIDATED
ZNF267 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 267
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003414.4-697s21c1
Sequence:CCGGATCAATATAGGAAGGTCTTTACTCGAGTAAAGACCTTCCTATATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003414.4-1376s21c1
Sequence:CCGGTACTCGTTCCTCCAATCTTATCTCGAGATAAGATTGGAGGAACGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003414.4-800s21c1
Sequence:CCGGTAGGCAGGTCTCTACTCTAAACTCGAGTTTAGAGTAGAGACCTGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003414.4-1194s21c1
Sequence:CCGGGATAGCTTAAACCATAGTTTGCTCGAGCAAACTATGGTTTAAGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003414.4-2757s21c1
Sequence:CCGGGAAGTTTGCAGATGCAATAAACTCGAGTTTATTGCATCTGCAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003414.3-2490s1c1
Sequence:CCGGCCTTACACAATAGCAGAGAATCTCGAGATTCTCTGCTATTGTGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_003414.3-1553s1c1
Sequence:CCGGGCTCGTTCTTCAAATCTTATTCTCGAGAATAAGATTTGAAGAACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003414.3-735s1c1
Sequence:CCGGCTACTCTAAATAGTTACCGAACTCGAGTTCGGTAACTATTTAGAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003414.3-200s1c1
Sequence:CCGGCCAGCTCAGAAGAATTTGTATCTCGAGATACAAATTCTTCTGAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003414.3-1794s1c1
Sequence:CCGGGCAAAGCCTTTCCTTATAGTTCTCGAGAACTATAAGGAAAGGCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks