EMAIL THIS PAGE TO A FRIEND

ZNF268

zinc finger protein 268

Synonyms: HZF3
UniProtKB ID: Q14587, Q96RH4, Q9BZJ9
Gene ID:
domestic cat(101094705) zinc finger protein 268
dog(100686147) zinc finger protein 268
cow(506621) zinc finger protein 268
sheep(101114390) zinc finger protein 268
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003415 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003415 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003415 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003415 Rosetta Predictions human pricing
NM_152943 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335616 predicted 1811
2 SASI_Hs01_00088665 predicted 1725
3 SASI_Hs01_00088666 predicted 2862
4 SASI_Hs01_00088668 predicted 1207
5 SASI_Hs01_00088669 predicted 489
6 SASI_Hs01_00088670 predicted 1350
7 SASI_Hs02_00335617 predicted 700
8 SASI_Hs02_00335618 predicted 925
9 SASI_Hs02_00335619 predicted 3206
10 SASI_Hs01_00088671 predicted 1863
11 SASI_Hs01_00088664 predicted 2709
12 SASI_Hs01_00088667 predicted 1073
13 SASI_Hs01_00088672 predicted 3273
14 SASI_Hs01_00088673 predicted 996
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082174 predicted 2668
2 SASI_Hs01_00082175 predicted 1683
3 SASI_Hs01_00082176 predicted 2832
4 SASI_Hs01_00082177 predicted 1035
5 SASI_Hs01_00082178 predicted 1712
6 SASI_Hs01_00082179 predicted 1171
7 SASI_Hs01_00082180 predicted 2230
8 SASI_Hs01_00082181 predicted 1317
9 SASI_Hs01_00082182 predicted 1833
10 SASI_Hs01_00082183 predicted 3236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003415
VALIDATED
ZNF268 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 268
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003415.1-944s1c1
Sequence:CCGGCGCATGGAAAGAGTTTGAAATCTCGAGATTTCAAACTCTTTCCATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003415.1-496s1c1
Sequence:CCGGCGCAGAATAGAGAAAGTCCTACTCGAGTAGGACTTTCTCTATTCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003415.1-2776s1c1
Sequence:CCGGGCCTTCATTTGGAAATCACTACTCGAGTAGTGATTTCCAAATGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003415.1-1449s1c1
Sequence:CCGGCCAGCTTGTTTCACACCAGAACTCGAGTTCTGGTGTGAAACAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003415.1-2517s1c1
Sequence:CCGGCGGGAAATCCTTTAGTTTCAACTCGAGTTGAAACTAAAGGATTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003415.1-2026s21c1
Sequence:CCGGAGTCGGAAATACCAGCTTATTCTCGAGAATAAGCTGGTATTTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003415.1-3585s21c1
Sequence:CCGGGCTAATGAATGGCAGAATTAACTCGAGTTAATTCTGCCATTCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003415.1-897s21c1
Sequence:CCGGTCTTAGTACAAAGTATCTTTCCTCGAGGAAAGATACTTTGTACTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003415.1-3157s21c1
Sequence:CCGGGTAGATGACAAACATTGATAACTCGAGTTATCAATGTTTGTCATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_003415.1-944s21c1
Sequence:CCGGCGCATGGAAAGAGTTTGAAATCTCGAGATTTCAAACTCTTTCCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003415
VALIDATED
ZNF268 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 268
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003415.1-944s1c1
Sequence:CCGGCGCATGGAAAGAGTTTGAAATCTCGAGATTTCAAACTCTTTCCATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003415.1-496s1c1
Sequence:CCGGCGCAGAATAGAGAAAGTCCTACTCGAGTAGGACTTTCTCTATTCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003415.1-2776s1c1
Sequence:CCGGGCCTTCATTTGGAAATCACTACTCGAGTAGTGATTTCCAAATGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003415.1-1449s1c1
Sequence:CCGGCCAGCTTGTTTCACACCAGAACTCGAGTTCTGGTGTGAAACAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003415.1-2517s1c1
Sequence:CCGGCGGGAAATCCTTTAGTTTCAACTCGAGTTGAAACTAAAGGATTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003415.1-2026s21c1
Sequence:CCGGAGTCGGAAATACCAGCTTATTCTCGAGAATAAGCTGGTATTTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003415.1-3585s21c1
Sequence:CCGGGCTAATGAATGGCAGAATTAACTCGAGTTAATTCTGCCATTCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003415.1-897s21c1
Sequence:CCGGTCTTAGTACAAAGTATCTTTCCTCGAGGAAAGATACTTTGTACTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003415.1-3157s21c1
Sequence:CCGGGTAGATGACAAACATTGATAACTCGAGTTATCAATGTTTGTCATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_003415.1-944s21c1
Sequence:CCGGCGCATGGAAAGAGTTTGAAATCTCGAGATTTCAAACTCTTTCCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003415
VALIDATED
ZNF268 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 268
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003415.1-944s1c1
Sequence:CCGGCGCATGGAAAGAGTTTGAAATCTCGAGATTTCAAACTCTTTCCATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003415.1-496s1c1
Sequence:CCGGCGCAGAATAGAGAAAGTCCTACTCGAGTAGGACTTTCTCTATTCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003415.1-2776s1c1
Sequence:CCGGGCCTTCATTTGGAAATCACTACTCGAGTAGTGATTTCCAAATGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003415.1-1449s1c1
Sequence:CCGGCCAGCTTGTTTCACACCAGAACTCGAGTTCTGGTGTGAAACAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003415.1-2517s1c1
Sequence:CCGGCGGGAAATCCTTTAGTTTCAACTCGAGTTGAAACTAAAGGATTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003415.1-2026s21c1
Sequence:CCGGAGTCGGAAATACCAGCTTATTCTCGAGAATAAGCTGGTATTTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003415.1-3585s21c1
Sequence:CCGGGCTAATGAATGGCAGAATTAACTCGAGTTAATTCTGCCATTCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003415.1-897s21c1
Sequence:CCGGTCTTAGTACAAAGTATCTTTCCTCGAGGAAAGATACTTTGTACTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003415.1-3157s21c1
Sequence:CCGGGTAGATGACAAACATTGATAACTCGAGTTATCAATGTTTGTCATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_003415.1-944s21c1
Sequence:CCGGCGCATGGAAAGAGTTTGAAATCTCGAGATTTCAAACTCTTTCCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks