EMAIL THIS PAGE TO A FRIEND

ZNF26

zinc finger protein 26

Synonyms: KOX20
UniProtKB ID: P17031, Q86X57, Q9NWL3
Gene ID:
domestic cat(101092895) zinc finger protein 26
dog(486219) zinc finger protein 26
domestic guinea pig(100727892) zinc finger protein 26
naked mole-rat(101725879) zinc finger protein 26
cow(784914) zinc finger protein 26
sheep(101113626) zinc finger protein 26
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019591 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019591 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019591 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU022351 MISSION® esiRNA esiRNA human ZNF26 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019591 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019591 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176540 predicted 746
2 SASI_Hs01_00176541 predicted 410
3 SASI_Hs02_00352786 predicted 686
4 SASI_Hs01_00176542 predicted 1928
5 SASI_Hs01_00176543 predicted 1466
6 SASI_Hs01_00176544 predicted 677
7 SASI_Hs01_00176545 predicted 2016
8 SASI_Hs01_00176546 predicted 1973
9 SASI_Hs02_00352787 predicted 1770
10 SASI_Hs01_00176547 predicted 568
11 SASI_Hs01_00176548 predicted 1331
12 SASI_Hs01_00176549 predicted 1767
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019591
VALIDATED
ZNF26 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 26
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_019591.2-738s21c1
Sequence:CCGGTCAAGACAGAGACTCTATAACCTCGAGGTTATAGAGTCTCTGTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019591.2-788s21c1
Sequence:GTACCGGAGCTCCAAGCAGAAGTTATTTCTCGAGAAATAACTTCTGCTTGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019591.2-1951s21c1
Sequence:CCGGTACATCGGAAGACTCATAAATCTCGAGATTTATGAGTCTTCCGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019591.2-2227s21c1
Sequence:CCGGTACACTAGGAACACCTTATAACTCGAGTTATAAGGTGTTCCTAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019591.2-1005s21c1
Sequence:GTACCGGAGTGCCAAGTCAAACCTTAATCTCGAGATTAAGGTTTGACTTGGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_019591.2-2019s1c1
Sequence:CCGGCGGATAATATAGACAGGATTTCTCGAGAAATCCTGTCTATATTATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_019591.2-669s1c1
Sequence:CCGGGAGAGTATTGAAAGAAGCTATCTCGAGATAGCTTCTTTCAATACTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019591.2-819s1c1
Sequence:CCGGCCTGATAAGTTTCATGGTTATCTCGAGATAACCATGAAACTTATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_019591.2-458s1c1
Sequence:CCGGGCTACTGGATTCTACACAGAACTCGAGTTCTGTGTAGAATCCAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019591.2-1706s1c1
Sequence:CCGGGAGAACTCATTCAACTGAGAACTCGAGTTCTCAGTTGAATGAGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019591
VALIDATED
ZNF26 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 26
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_019591.2-738s21c1
Sequence:CCGGTCAAGACAGAGACTCTATAACCTCGAGGTTATAGAGTCTCTGTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019591.2-788s21c1
Sequence:GTACCGGAGCTCCAAGCAGAAGTTATTTCTCGAGAAATAACTTCTGCTTGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019591.2-1951s21c1
Sequence:CCGGTACATCGGAAGACTCATAAATCTCGAGATTTATGAGTCTTCCGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019591.2-2227s21c1
Sequence:CCGGTACACTAGGAACACCTTATAACTCGAGTTATAAGGTGTTCCTAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019591.2-1005s21c1
Sequence:GTACCGGAGTGCCAAGTCAAACCTTAATCTCGAGATTAAGGTTTGACTTGGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_019591.2-2019s1c1
Sequence:CCGGCGGATAATATAGACAGGATTTCTCGAGAAATCCTGTCTATATTATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_019591.2-669s1c1
Sequence:CCGGGAGAGTATTGAAAGAAGCTATCTCGAGATAGCTTCTTTCAATACTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019591.2-819s1c1
Sequence:CCGGCCTGATAAGTTTCATGGTTATCTCGAGATAACCATGAAACTTATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_019591.2-458s1c1
Sequence:CCGGGCTACTGGATTCTACACAGAACTCGAGTTCTGTGTAGAATCCAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019591.2-1706s1c1
Sequence:CCGGGAGAACTCATTCAACTGAGAACTCGAGTTCTCAGTTGAATGAGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019591
VALIDATED
ZNF26 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 26
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_019591.2-738s21c1
Sequence:CCGGTCAAGACAGAGACTCTATAACCTCGAGGTTATAGAGTCTCTGTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019591.2-788s21c1
Sequence:GTACCGGAGCTCCAAGCAGAAGTTATTTCTCGAGAAATAACTTCTGCTTGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019591.2-1951s21c1
Sequence:CCGGTACATCGGAAGACTCATAAATCTCGAGATTTATGAGTCTTCCGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019591.2-2227s21c1
Sequence:CCGGTACACTAGGAACACCTTATAACTCGAGTTATAAGGTGTTCCTAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019591.2-1005s21c1
Sequence:GTACCGGAGTGCCAAGTCAAACCTTAATCTCGAGATTAAGGTTTGACTTGGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_019591.2-2019s1c1
Sequence:CCGGCGGATAATATAGACAGGATTTCTCGAGAAATCCTGTCTATATTATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_019591.2-669s1c1
Sequence:CCGGGAGAGTATTGAAAGAAGCTATCTCGAGATAGCTTCTTTCAATACTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019591.2-819s1c1
Sequence:CCGGCCTGATAAGTTTCATGGTTATCTCGAGATAACCATGAAACTTATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_019591.2-458s1c1
Sequence:CCGGGCTACTGGATTCTACACAGAACTCGAGTTCTGTGTAGAATCCAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019591.2-1706s1c1
Sequence:CCGGGAGAACTCATTCAACTGAGAACTCGAGTTCTCAGTTGAATGAGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks