EMAIL THIS PAGE TO A FRIEND

ZNF271

zinc finger protein 271

Synonyms: HZF7 ZNFEB
UniProtKB ID: Q14591, B3KN34, Q96T29, Q9BSX2, Q9UN33, Q9Y5B7
Gene ID:
cow(767868) zinc finger protein 271
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006629 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006629 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006629 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001112663 Rosetta Predictions human pricing
NM_006629 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325395 predicted 1908
2 SASI_Hs02_00325396 predicted 1030
3 SASI_Hs02_00325397 predicted 1072
4 SASI_Hs02_00325398 predicted 1321
5 SASI_Hs02_00325399 predicted 1532
6 SASI_Hs02_00325400 predicted 1617
7 SASI_Hs02_00325401 predicted 1898
8 SASI_Hs02_00325402 predicted 1859
9 SASI_Hs02_00325403 predicted 1870
10 SASI_Hs02_00325404 predicted 1619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006629 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191774 predicted 1690
2 SASI_Hs01_00191775 predicted 807
3 SASI_Hs01_00191776 predicted 854
4 SASI_Hs01_00191777 predicted 1100
5 SASI_Hs01_00191778 predicted 1313
6 SASI_Hs01_00191779 predicted 1391
7 SASI_Hs01_00191780 predicted 1673
8 SASI_Hs01_00191781 predicted 1644
9 SASI_Hs01_00191782 predicted 1642
10 SASI_Hs02_00341978 predicted 1394
11 SASI_Hs01_00191783 predicted 1227
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006629
ZNF271 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 271
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006629.3-2008s1c1
Sequence:CCGGGTTCAACTCTTATGCTACATTCTCGAGAATGTAGCATAAGAGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006629.3-1824s1c1
Sequence:CCGGGCCAACTCTCTGAACTTACTACTCGAGTAGTAAGTTCAGAGAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006629.3-950s1c1
Sequence:CCGGCCTATCCCTGTGATCAATGTACTCGAGTACATTGATCACAGGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006629.3-1038s1c1
Sequence:CCGGCCCATGTAATCAGTGCAATAACTCGAGTTATTGCACTGATTACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006629.3-1207s1c1
Sequence:CCGGGCATGTAGTGATTGTACTAAACTCGAGTTTAGTACAATCACTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006629
ZNF271 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 271
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006629.3-2008s1c1
Sequence:CCGGGTTCAACTCTTATGCTACATTCTCGAGAATGTAGCATAAGAGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006629.3-1824s1c1
Sequence:CCGGGCCAACTCTCTGAACTTACTACTCGAGTAGTAAGTTCAGAGAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006629.3-950s1c1
Sequence:CCGGCCTATCCCTGTGATCAATGTACTCGAGTACATTGATCACAGGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006629.3-1038s1c1
Sequence:CCGGCCCATGTAATCAGTGCAATAACTCGAGTTATTGCACTGATTACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006629.3-1207s1c1
Sequence:CCGGGCATGTAGTGATTGTACTAAACTCGAGTTTAGTACAATCACTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006629
ZNF271 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 271
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006629.3-2008s1c1
Sequence:CCGGGTTCAACTCTTATGCTACATTCTCGAGAATGTAGCATAAGAGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006629.3-1824s1c1
Sequence:CCGGGCCAACTCTCTGAACTTACTACTCGAGTAGTAAGTTCAGAGAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006629.3-950s1c1
Sequence:CCGGCCTATCCCTGTGATCAATGTACTCGAGTACATTGATCACAGGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006629.3-1038s1c1
Sequence:CCGGCCCATGTAATCAGTGCAATAACTCGAGTTATTGCACTGATTACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006629.3-1207s1c1
Sequence:CCGGGCATGTAGTGATTGTACTAAACTCGAGTTTAGTACAATCACTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks