EMAIL THIS PAGE TO A FRIEND

ZNF273

zinc finger protein 273

Synonyms: HZF9
UniProtKB ID: Q14593, B3KQZ5, Q6P3V4
Gene ID:
Human(10793) Summary: This gene is a member of the krueppel C2H2-type zinc-finger protein family and encodes a protein with 13 C2H2-type zinc fingers and a KRAB domain. This nuclear protein is involved in transcriptional regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
cow(100140550) zinc finger protein 267-like
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301251 ANTI-ZN273 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021148 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021148 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021148 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021148 Rosetta Predictions human pricing
NR_003099 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021148 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170593 predicted 1826
2 SASI_Hs01_00170594 predicted 1684
3 SASI_Hs01_00170595 predicted 844
4 SASI_Hs02_00354684 predicted 239
5 SASI_Hs01_00170597 predicted 1808
6 SASI_Hs01_00170596 predicted 633
7 SASI_Hs01_00170598 predicted 1828
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003099 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378216 predicted 2197
2 SASI_Hs02_00378217 predicted 1909
3 SASI_Hs02_00378218 predicted 251
4 SASI_Hs02_00378219 predicted 2179
5 SASI_Hs02_00378220 predicted 1776
6 SASI_Hs02_00378221 predicted 2114
7 SASI_Hs02_00378222 predicted 2386
8 SASI_Hs02_00378223 predicted 2129
9 SASI_Hs02_00378224 predicted 935
10 SASI_Hs02_00378225 predicted 2188
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021148
ZNF273 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 273
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108010    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021148.1-3050s1c1
Sequence:CCGGGCTGCATCAAAGATATGAGATCTCGAGATCTCATATCTTTGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021148.1-899s1c1
Sequence:CCGGTCCTGAAGTGAATCCCTACAACTCGAGTTGTAGGGATTCACTTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021148.1-1744s1c1
Sequence:CCGGGAGAGAAACCATACAAACCTACTCGAGTAGGTTTGTATGGTTTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021148.1-812s1c1
Sequence:CCGGTGCTACTAGAGTGAATTTCTACTCGAGTAGAAATTCACTCTAGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021148.1-947s1c1
Sequence:CCGGCCAGTCCTTAACTCTTACTAACTCGAGTTAGTAAGAGTTAAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021148
ZNF273 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 273
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108010    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021148.1-3050s1c1
Sequence:CCGGGCTGCATCAAAGATATGAGATCTCGAGATCTCATATCTTTGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021148.1-899s1c1
Sequence:CCGGTCCTGAAGTGAATCCCTACAACTCGAGTTGTAGGGATTCACTTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021148.1-1744s1c1
Sequence:CCGGGAGAGAAACCATACAAACCTACTCGAGTAGGTTTGTATGGTTTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021148.1-812s1c1
Sequence:CCGGTGCTACTAGAGTGAATTTCTACTCGAGTAGAAATTCACTCTAGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021148.1-947s1c1
Sequence:CCGGCCAGTCCTTAACTCTTACTAACTCGAGTTAGTAAGAGTTAAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021148
ZNF273 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 273
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108010    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021148.1-3050s1c1
Sequence:CCGGGCTGCATCAAAGATATGAGATCTCGAGATCTCATATCTTTGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021148.1-899s1c1
Sequence:CCGGTCCTGAAGTGAATCCCTACAACTCGAGTTGTAGGGATTCACTTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021148.1-1744s1c1
Sequence:CCGGGAGAGAAACCATACAAACCTACTCGAGTAGGTTTGTATGGTTTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021148.1-812s1c1
Sequence:CCGGTGCTACTAGAGTGAATTTCTACTCGAGTAGAAATTCACTCTAGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021148.1-947s1c1
Sequence:CCGGCCAGTCCTTAACTCTTACTAACTCGAGTTAGTAAGAGTTAAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks