EMAIL THIS PAGE TO A FRIEND

ZNF274

zinc finger protein 274

Synonyms: HFB101 ZF2 ZKSCAN19 ZSCAN51
Gene ID:
Human(10782) Summary: This gene encodes a zinc finger protein containing five C2H2-type zinc finger domains, one or two Kruppel-associated box A (KRAB A) domains, and a leucine-rich domain. The encoded protein has been suggested to be a transcriptional repressor. It localizes predominantly to the nucleolus. Alternatively spliced transcript variants encoding different isoforms exist. These variants utilize alternative polyadenylation signals. [provided by RefSeq, Jul 2008]
cow(534170) zinc finger protein 274
sheep(101119156) zinc finger protein 274
Domestic Rabbit(100353479) zinc finger protein 274
naked mole-rat(101699802) zinc finger protein 274
domestic guinea pig(100730170) zinc finger protein 274
dog(476367) zinc finger protein 274
domestic cat(101087951) zinc finger protein 274
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016324 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016324 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016324 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083441 MISSION® esiRNA esiRNA human ZNF274 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016324 Rosetta Predictions human pricing
NM_016325 Rosetta Predictions human pricing
NM_133502 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016324 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349266 predicted 1616
2 SASI_Hs01_00127385 predicted 2114
3 SASI_Hs01_00127386 predicted 2002
4 SASI_Hs01_00127387 predicted 2075
5 SASI_Hs01_00127390 predicted 1664
6 SASI_Hs02_00349267 predicted 2213
7 SASI_Hs01_00127391 predicted 1627
8 SASI_Hs01_00127393 predicted 1583
9 SASI_Hs02_00349268 predicted 1451
10 SASI_Hs01_00127394 predicted 1503
11 SASI_Hs01_00127388 predicted 1240
12 SASI_Hs01_00127389 predicted 1537
13 SASI_Hs01_00127392 predicted 1758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349269 predicted 1817
2 SASI_Hs01_00107132 predicted 2322
3 SASI_Hs01_00107133 predicted 2208
4 SASI_Hs01_00107134 predicted 2277
5 SASI_Hs01_00107137 predicted 1865
6 SASI_Hs02_00349270 predicted 2412
7 SASI_Hs01_00107138 predicted 1833
8 SASI_Hs01_00107140 predicted 1791
9 SASI_Hs02_00349271 predicted 1655
10 SASI_Hs01_00107141 predicted 1711
11 SASI_Hs01_00107135 predicted 1438
12 SASI_Hs01_00107136 predicted 1745
13 SASI_Hs01_00107139 predicted 1966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133502 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363230 predicted 1919
2 SASI_Hs01_00126054 predicted 2418
3 SASI_Hs01_00126055 predicted 2301
4 SASI_Hs01_00126056 predicted 2378
5 SASI_Hs01_00126059 predicted 1963
6 SASI_Hs02_00363231 predicted 2515
7 SASI_Hs01_00126060 predicted 1921
8 SASI_Hs01_00126062 predicted 1886
9 SASI_Hs02_00363232 predicted 1755
10 SASI_Hs01_00126063 predicted 1803
11 SASI_Hs01_00126057 predicted 1532
12 SASI_Hs01_00126058 predicted 1834
13 SASI_Hs01_00126061 predicted 2066
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016324
VALIDATED
ZNF274 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 274
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016324.2-2078s1c1
Sequence:CCGGCCACAATAGGACAAAGCGAAACTCGAGTTTCGCTTTGTCCTATTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016324.2-1207s1c1
Sequence:CCGGCCAGCCTGAAAGTACAAGAATCTCGAGATTCTTGTACTTTCAGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_016324.2-1509s1c1
Sequence:CCGGCGCAAACGTGACTCACAAGTTCTCGAGAACTTGTGAGTCACGTTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016324.2-543s1c1
Sequence:CCGGCAGGCCCTATATGCTGAAGATCTCGAGATCTTCAGCATATAGGGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016324.2-2008s1c1
Sequence:CCGGGCCCATATGCATGCAACAAATCTCGAGATTTGTTGCATGCATATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016324.2-648s21c1
Sequence:CCGGTTCCGGCAGTTCCGTTATAAGCTCGAGCTTATAACGGAACTGCCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016324.2-2354s21c1
Sequence:CCGGTGTTCACTCATTTAGTCATTACTCGAGTAATGACTAAATGAGTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_016324.2-1391s21c1
Sequence:GTACCGGTCTTGACACAAACCAAGTTTCCTCGAGGAAACTTGGTTTGTGTCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016324.2-1617s21c1
Sequence:CCGGACCTTCAGTCGGAGTACTAAACTCGAGTTTAGTACTCCGACTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_016324.2-1511s21c1
Sequence:CCGGCAAACGTGACTCACAAGTTAACTCGAGTTAACTTGTGAGTCACGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016324
VALIDATED
ZNF274 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 274
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016324.2-2078s1c1
Sequence:CCGGCCACAATAGGACAAAGCGAAACTCGAGTTTCGCTTTGTCCTATTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016324.2-1207s1c1
Sequence:CCGGCCAGCCTGAAAGTACAAGAATCTCGAGATTCTTGTACTTTCAGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_016324.2-1509s1c1
Sequence:CCGGCGCAAACGTGACTCACAAGTTCTCGAGAACTTGTGAGTCACGTTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016324.2-543s1c1
Sequence:CCGGCAGGCCCTATATGCTGAAGATCTCGAGATCTTCAGCATATAGGGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016324.2-2008s1c1
Sequence:CCGGGCCCATATGCATGCAACAAATCTCGAGATTTGTTGCATGCATATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016324.2-648s21c1
Sequence:CCGGTTCCGGCAGTTCCGTTATAAGCTCGAGCTTATAACGGAACTGCCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016324.2-2354s21c1
Sequence:CCGGTGTTCACTCATTTAGTCATTACTCGAGTAATGACTAAATGAGTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_016324.2-1391s21c1
Sequence:GTACCGGTCTTGACACAAACCAAGTTTCCTCGAGGAAACTTGGTTTGTGTCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016324.2-1617s21c1
Sequence:CCGGACCTTCAGTCGGAGTACTAAACTCGAGTTTAGTACTCCGACTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_016324.2-1511s21c1
Sequence:CCGGCAAACGTGACTCACAAGTTAACTCGAGTTAACTTGTGAGTCACGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016324
VALIDATED
ZNF274 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 274
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016324.2-2078s1c1
Sequence:CCGGCCACAATAGGACAAAGCGAAACTCGAGTTTCGCTTTGTCCTATTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016324.2-1207s1c1
Sequence:CCGGCCAGCCTGAAAGTACAAGAATCTCGAGATTCTTGTACTTTCAGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_016324.2-1509s1c1
Sequence:CCGGCGCAAACGTGACTCACAAGTTCTCGAGAACTTGTGAGTCACGTTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016324.2-543s1c1
Sequence:CCGGCAGGCCCTATATGCTGAAGATCTCGAGATCTTCAGCATATAGGGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016324.2-2008s1c1
Sequence:CCGGGCCCATATGCATGCAACAAATCTCGAGATTTGTTGCATGCATATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016324.2-648s21c1
Sequence:CCGGTTCCGGCAGTTCCGTTATAAGCTCGAGCTTATAACGGAACTGCCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016324.2-2354s21c1
Sequence:CCGGTGTTCACTCATTTAGTCATTACTCGAGTAATGACTAAATGAGTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_016324.2-1391s21c1
Sequence:GTACCGGTCTTGACACAAACCAAGTTTCCTCGAGGAAACTTGGTTTGTGTCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016324.2-1617s21c1
Sequence:CCGGACCTTCAGTCGGAGTACTAAACTCGAGTTTAGTACTCCGACTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_016324.2-1511s21c1
Sequence:CCGGCAAACGTGACTCACAAGTTAACTCGAGTTAACTTGTGAGTCACGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks