EMAIL THIS PAGE TO A FRIEND

ZNF275

zinc finger protein 275

UniProtKB ID: Q9NSD4
Gene ID:
Human(10838) Summary: This gene encodes a zinc finger protein that appears to be conserved in eutheria. Its function has not yet been established. [provided by RefSeq, Jul 2010]
Horse(100057591) zinc finger protein 275
dog(492233) zinc finger protein 275
domestic guinea pig(100730135) zinc finger protein 275
naked mole-rat(101711208) zinc finger protein 275
Domestic Rabbit(100346859) zinc finger protein 275
cow(532314) zinc finger protein 275
sheep(101103131) zinc finger protein 275
130 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080485 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080485 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080485 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_372267 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372267 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372267 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU143501 MISSION® esiRNA esiRNA human ZNF275 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080485 Rosetta Predictions human pricing
XM_372267 Rosetta Predictions human pricing
XM_927180 Rosetta Predictions human pricing
XM_931920 Rosetta Predictions human pricing
XM_931925 Rosetta Predictions human pricing
XM_931930 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080485 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315296 predicted 800
2 SASI_Hs02_00315297 predicted 786
3 SASI_Hs02_00315298 predicted 499
4 SASI_Hs02_00315299 predicted 782
5 SASI_Hs02_00315300 predicted 274
6 SASI_Hs02_00315301 predicted 236
7 SASI_Hs02_00315302 predicted 836
8 SASI_Hs02_00315303 predicted 378
9 SASI_Hs02_00315304 predicted 422
10 SASI_Hs02_00315305 predicted 1243
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372267 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00295658 predicted 1458
2 SASI_Hs01_00295659 predicted 1434
3 SASI_Hs01_00295660 predicted 1147
4 SASI_Hs01_00295661 predicted 1440
5 SASI_Hs01_00295662 predicted 1491
6 SASI_Hs01_00295663 predicted 1031
7 SASI_Hs01_00295664 predicted 1081
8 SASI_Hs01_00295665 predicted 1901
9 SASI_Hs01_00295666 predicted 1006
10 SASI_Hs01_00295667 predicted 1328
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272386 predicted 942
2 SASI_Hs01_00272387 predicted 920
3 SASI_Hs01_00272388 predicted 631
4 SASI_Hs01_00272389 predicted 925
5 SASI_Hs01_00272390 predicted 979
6 SASI_Hs01_00272391 predicted 522
7 SASI_Hs01_00272392 predicted 561
8 SASI_Hs01_00272393 predicted 1385
9 SASI_Hs01_00272394 predicted 488
10 SASI_Hs01_00272395 predicted 820
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931920 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00285300 predicted 943
2 SASI_Hs01_00285301 predicted 928
3 SASI_Hs01_00285302 predicted 640
4 SASI_Hs01_00285303 predicted 927
5 SASI_Hs01_00285304 predicted 975
6 SASI_Hs01_00285305 predicted 525
7 SASI_Hs01_00285306 predicted 567
8 SASI_Hs01_00285307 predicted 1383
9 SASI_Hs01_00285308 predicted 494
10 SASI_Hs01_00285309 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00293113 predicted 943
2 SASI_Hs01_00293114 predicted 926
3 SASI_Hs01_00293115 predicted 637
4 SASI_Hs01_00293116 predicted 930
5 SASI_Hs01_00293117 predicted 973
6 SASI_Hs01_00293118 predicted 519
7 SASI_Hs01_00293119 predicted 559
8 SASI_Hs01_00293120 predicted 1391
9 SASI_Hs01_00293121 predicted 496
10 SASI_Hs01_00293122 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931930 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00300793 predicted 806
2 SASI_Hs01_00300794 predicted 791
3 SASI_Hs01_00300795 predicted 506
4 SASI_Hs01_00300796 predicted 791
5 SASI_Hs01_00300797 predicted 282
6 SASI_Hs01_00300798 predicted 236
7 SASI_Hs01_00300799 predicted 840
8 SASI_Hs01_00300800 predicted 383
9 SASI_Hs01_00300801 predicted 1154
10 SASI_Hs01_00300802 predicted 356
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080485
ZNF275 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 275
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000435319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080485.2-497s21c1
Sequence:CCGGGGGACACCTTTCGGCTTAAAGCTCGAGCTTTAAGCCGAAAGGTGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080485.2-1678s21c1
Sequence:CCGGGAAGTACCATCAAGGTATTTCCTCGAGGAAATACCTTGATGGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080485
ZNF275 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 275
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000435319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080485.2-497s21c1
Sequence:CCGGGGGACACCTTTCGGCTTAAAGCTCGAGCTTTAAGCCGAAAGGTGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080485.2-1678s21c1
Sequence:CCGGGAAGTACCATCAAGGTATTTCCTCGAGGAAATACCTTGATGGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080485
ZNF275 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 275
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000435319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080485.2-497s21c1
Sequence:CCGGGGGACACCTTTCGGCTTAAAGCTCGAGCTTTAAGCCGAAAGGTGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080485.2-1678s21c1
Sequence:CCGGGAAGTACCATCAAGGTATTTCCTCGAGGAAATACCTTGATGGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372267
ZNF275 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 275
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372267.2-397s1c1
Sequence:CCGGCCACAGAATCTGCCCATAGAACTCGAGTTCTATGGGCAGATTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372267.2-1245s1c1
Sequence:CCGGGAAACCCTATGAGTGCGACAACTCGAGTTGTCGCACTCATAGGGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372267.2-805s1c1
Sequence:CCGGCAGAAACTTCACACTTCGGAACTCGAGTTCCGAAGTGTGAAGTTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372267.2-30s1c1
Sequence:CCGGCTGGGAATTCTTTCAGGATTTCTCGAGAAATCCTGAAAGAATTCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372267.2-743s1c1
Sequence:CCGGAGCCCTTTGATTGCGAGGAATCTCGAGATTCCTCGCAATCAAAGGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372267
ZNF275 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 275
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372267.2-397s1c1
Sequence:CCGGCCACAGAATCTGCCCATAGAACTCGAGTTCTATGGGCAGATTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372267.2-1245s1c1
Sequence:CCGGGAAACCCTATGAGTGCGACAACTCGAGTTGTCGCACTCATAGGGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372267.2-805s1c1
Sequence:CCGGCAGAAACTTCACACTTCGGAACTCGAGTTCCGAAGTGTGAAGTTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372267.2-30s1c1
Sequence:CCGGCTGGGAATTCTTTCAGGATTTCTCGAGAAATCCTGAAAGAATTCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372267.2-743s1c1
Sequence:CCGGAGCCCTTTGATTGCGAGGAATCTCGAGATTCCTCGCAATCAAAGGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372267
ZNF275 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 275
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372267.2-397s1c1
Sequence:CCGGCCACAGAATCTGCCCATAGAACTCGAGTTCTATGGGCAGATTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372267.2-1245s1c1
Sequence:CCGGGAAACCCTATGAGTGCGACAACTCGAGTTGTCGCACTCATAGGGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372267.2-805s1c1
Sequence:CCGGCAGAAACTTCACACTTCGGAACTCGAGTTCCGAAGTGTGAAGTTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372267.2-30s1c1
Sequence:CCGGCTGGGAATTCTTTCAGGATTTCTCGAGAAATCCTGAAAGAATTCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372267.2-743s1c1
Sequence:CCGGAGCCCTTTGATTGCGAGGAATCTCGAGATTCCTCGCAATCAAAGGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks