EMAIL THIS PAGE TO A FRIEND

ZNF276

zinc finger protein 276

Synonyms: CENP-Z CENPZ ZFP276 ZNF477
UniProtKB ID: Q8N554, Q0VGA1, Q2TBE8, Q3B7H7
Gene ID:
cow(513761) zinc finger protein 276
sheep(101111739) zinc finger protein 276
naked mole-rat(101699899) zinc finger protein 276
domestic guinea pig(100728745) zinc finger protein 276
chicken(415853) zinc finger protein 276
Horse(100052435) zinc finger protein 276
domestic cat(101081182) zinc finger protein 276
dog(489653) zinc finger protein 276
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152287 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152287 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152287 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU160141 MISSION® esiRNA esiRNA human ZNF276 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001113525 Rosetta Predictions human pricing
NM_152287 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326001 predicted 1294
2 SASI_Hs02_00326002 predicted 1274
3 SASI_Hs02_00326003 predicted 1236
4 SASI_Hs02_00326004 predicted 1297
5 SASI_Hs02_00326005 predicted 862
6 SASI_Hs02_00326006 predicted 1319
7 SASI_Hs02_00326007 predicted 867
8 SASI_Hs02_00326008 predicted 1445
9 SASI_Hs02_00326009 predicted 1384
10 SASI_Hs02_00326010 predicted 1299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152287 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365837 predicted 1288
2 SASI_Hs02_00365838 predicted 1262
3 SASI_Hs02_00365839 predicted 1222
4 SASI_Hs02_00365840 predicted 1286
5 SASI_Hs01_00227093 predicted 857
6 SASI_Hs01_00227094 predicted 1306
7 SASI_Hs02_00365841 predicted 856
8 SASI_Hs01_00227096 predicted 1435
9 SASI_Hs01_00227097 predicted 1377
10 SASI_Hs02_00365842 predicted 1290
11 SASI_Hs01_00227089 predicted 2184
12 SASI_Hs01_00227090 predicted 1701
13 SASI_Hs01_00227091 predicted 1674
14 SASI_Hs01_00227092 predicted 1527
15 SASI_Hs01_00227095 predicted 2143
16 SASI_Hs01_00227098 predicted 1212
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152287
ZNF276 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 276
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152287.2-1394s1c1
Sequence:CCGGCGGCATGAAGAAGCACATCAACTCGAGTTGATGTGCTTCTTCATGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152287.2-1249s1c1
Sequence:CCGGCCAAGAAGTCTGAAGAACCAACTCGAGTTGGTTCTTCAGACTTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152287.2-1339s1c1
Sequence:CCGGCCACCATCTACAAGTGTCCTTCTCGAGAAGGACACTTGTAGATGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152287.2-1077s1c1
Sequence:CCGGCCATCTTCAACCTCGGATGATCTCGAGATCATCCGAGGTTGAAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152287.2-1192s1c1
Sequence:CCGGCCTTTGAGCCTTACCCAGAAACTCGAGTTTCTGGGTAAGGCTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152287
ZNF276 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 276
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152287.2-1394s1c1
Sequence:CCGGCGGCATGAAGAAGCACATCAACTCGAGTTGATGTGCTTCTTCATGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152287.2-1249s1c1
Sequence:CCGGCCAAGAAGTCTGAAGAACCAACTCGAGTTGGTTCTTCAGACTTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152287.2-1339s1c1
Sequence:CCGGCCACCATCTACAAGTGTCCTTCTCGAGAAGGACACTTGTAGATGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152287.2-1077s1c1
Sequence:CCGGCCATCTTCAACCTCGGATGATCTCGAGATCATCCGAGGTTGAAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152287.2-1192s1c1
Sequence:CCGGCCTTTGAGCCTTACCCAGAAACTCGAGTTTCTGGGTAAGGCTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152287
ZNF276 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 276
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152287.2-1394s1c1
Sequence:CCGGCGGCATGAAGAAGCACATCAACTCGAGTTGATGTGCTTCTTCATGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152287.2-1249s1c1
Sequence:CCGGCCAAGAAGTCTGAAGAACCAACTCGAGTTGGTTCTTCAGACTTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152287.2-1339s1c1
Sequence:CCGGCCACCATCTACAAGTGTCCTTCTCGAGAAGGACACTTGTAGATGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152287.2-1077s1c1
Sequence:CCGGCCATCTTCAACCTCGGATGATCTCGAGATCATCCGAGGTTGAAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152287.2-1192s1c1
Sequence:CCGGCCTTTGAGCCTTACCCAGAAACTCGAGTTTCTGGGTAAGGCTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks