EMAIL THIS PAGE TO A FRIEND

ZNF277

zinc finger protein 277

Synonyms: NRIF4 ZNF277P
UniProtKB ID: Q9NRM2, Q75MZ2, Q75MZ3, Q8WY14
Gene ID:
Zebrafish(393402) zinc finger protein 277
chicken(427859) zinc finger protein 277
dog(475289) zinc finger protein 277
domestic cat(101087144) zinc finger protein 277
Horse(100070827) zinc finger protein 277
domestic guinea pig(100716451) zinc finger protein 277
naked mole-rat(101720723) zinc finger protein 277
Domestic Rabbit(100356034) zinc finger protein 277
cow(508663) zinc finger protein 277
sheep(101112808) zinc finger protein 277
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021994 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021994 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021994 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU100621 MISSION® esiRNA esiRNA human ZNF277P (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021994 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021994 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041428 predicted 352
2 SASI_Hs01_00041429 predicted 1175
3 SASI_Hs01_00041430 predicted 370
4 SASI_Hs01_00041432 predicted 992
5 SASI_Hs02_00355362 predicted 915
6 SASI_Hs01_00041433 predicted 621
7 SASI_Hs01_00041434 predicted 867
8 SASI_Hs01_00041435 predicted 1095
9 SASI_Hs01_00041436 predicted 1151
10 SASI_Hs02_00355363 predicted 1302
11 SASI_Hs01_00041427 predicted 1068
12 SASI_Hs01_00041431 predicted 820
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021994
VALIDATED
ZNF277 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 277
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_021994.1-1298s1c1
Sequence:CCGGCGTGGGATCAACTGGAGTATTCTCGAGAATACTCCAGTTGATCCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021994.1-1441s1c1
Sequence:CCGGGCTTTGAAACAAAGCAGTATTCTCGAGAATACTGCTTTGTTTCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021994.1-278s1c1
Sequence:CCGGCCACTTTAGAAGGTTCTCCATCTCGAGATGGAGAACCTTCTAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_021994.1-801s1c1
Sequence:CCGGGCAGTGCTTGTACTGTGAGAACTCGAGTTCTCACAGTACAAGCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_021994.1-409s1c1
Sequence:CCGGGCTGATTTCCAAAGGTACATTCTCGAGAATGTACCTTTGGAAATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_021994.2-621s21c1
Sequence:CCGGAGAACGAAATGATACCAATTTCTCGAGAAATTGGTATCATTTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_021994.2-1154s21c1
Sequence:CCGGAGCAAGTGAAACTGGTCAATTCTCGAGAATTGACCAGTTTCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021994.2-1903s21c1
Sequence:CCGGATATCCCTTCTGTACTATATTCTCGAGAATATAGTACAGAAGGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_021994.2-1090s21c1
Sequence:CCGGATGGAGGATGCACACGAATTTCTCGAGAAATTCGTGTGCATCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_021994.2-1300s21c1
Sequence:CCGGTGGGATCAACTGGAGTATTATCTCGAGATAATACTCCAGTTGATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021994
VALIDATED
ZNF277 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 277
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_021994.1-1298s1c1
Sequence:CCGGCGTGGGATCAACTGGAGTATTCTCGAGAATACTCCAGTTGATCCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021994.1-1441s1c1
Sequence:CCGGGCTTTGAAACAAAGCAGTATTCTCGAGAATACTGCTTTGTTTCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021994.1-278s1c1
Sequence:CCGGCCACTTTAGAAGGTTCTCCATCTCGAGATGGAGAACCTTCTAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_021994.1-801s1c1
Sequence:CCGGGCAGTGCTTGTACTGTGAGAACTCGAGTTCTCACAGTACAAGCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_021994.1-409s1c1
Sequence:CCGGGCTGATTTCCAAAGGTACATTCTCGAGAATGTACCTTTGGAAATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_021994.2-621s21c1
Sequence:CCGGAGAACGAAATGATACCAATTTCTCGAGAAATTGGTATCATTTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_021994.2-1154s21c1
Sequence:CCGGAGCAAGTGAAACTGGTCAATTCTCGAGAATTGACCAGTTTCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021994.2-1903s21c1
Sequence:CCGGATATCCCTTCTGTACTATATTCTCGAGAATATAGTACAGAAGGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_021994.2-1090s21c1
Sequence:CCGGATGGAGGATGCACACGAATTTCTCGAGAAATTCGTGTGCATCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_021994.2-1300s21c1
Sequence:CCGGTGGGATCAACTGGAGTATTATCTCGAGATAATACTCCAGTTGATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021994
VALIDATED
ZNF277 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 277
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_021994.1-1298s1c1
Sequence:CCGGCGTGGGATCAACTGGAGTATTCTCGAGAATACTCCAGTTGATCCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021994.1-1441s1c1
Sequence:CCGGGCTTTGAAACAAAGCAGTATTCTCGAGAATACTGCTTTGTTTCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021994.1-278s1c1
Sequence:CCGGCCACTTTAGAAGGTTCTCCATCTCGAGATGGAGAACCTTCTAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_021994.1-801s1c1
Sequence:CCGGGCAGTGCTTGTACTGTGAGAACTCGAGTTCTCACAGTACAAGCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_021994.1-409s1c1
Sequence:CCGGGCTGATTTCCAAAGGTACATTCTCGAGAATGTACCTTTGGAAATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_021994.2-621s21c1
Sequence:CCGGAGAACGAAATGATACCAATTTCTCGAGAAATTGGTATCATTTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_021994.2-1154s21c1
Sequence:CCGGAGCAAGTGAAACTGGTCAATTCTCGAGAATTGACCAGTTTCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021994.2-1903s21c1
Sequence:CCGGATATCCCTTCTGTACTATATTCTCGAGAATATAGTACAGAAGGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_021994.2-1090s21c1
Sequence:CCGGATGGAGGATGCACACGAATTTCTCGAGAAATTCGTGTGCATCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_021994.2-1300s21c1
Sequence:CCGGTGGGATCAACTGGAGTATTATCTCGAGATAATACTCCAGTTGATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks