EMAIL THIS PAGE TO A FRIEND

ZNF280A

zinc finger protein 280A

Synonyms: 3'OY11.1 SUHW1 ZNF280 ZNF636
UniProtKB ID: P59817
Gene ID:
Human(129025) Summary: This gene was predicted both by automated computational analysis and by similarity to a Drosophila gene and to predicted genes in other species (sheep, chimp, dog, cow). The predicted protein of this gene is similar to Drosophila suppressor of hairy wing protein, a leucine zipper protein which represses the function of transcriptional enhancers of the gypsy retrotransposon. [provided by RefSeq, Jul 2008]
cow(518200) zinc finger protein 280A
sheep(101117791) zinc finger protein 280A
naked mole-rat(101711267) zinc finger protein 280A
domestic guinea pig(100731967) zinc finger protein 280A
34 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080740 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080740 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080740 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052001 MISSION® esiRNA esiRNA human ZNF280A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080740 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080740 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111955 predicted 1636
2 SASI_Hs01_00111956 predicted 542
3 SASI_Hs01_00111958 predicted 516
4 SASI_Hs01_00111959 predicted 1754
5 SASI_Hs02_00362523 predicted 382
6 SASI_Hs01_00111961 predicted 636
7 SASI_Hs01_00111962 predicted 589
8 SASI_Hs02_00362524 predicted 319
9 SASI_Hs02_00362525 predicted 386
10 SASI_Hs02_00362526 predicted 1564
11 SASI_Hs01_00111954 predicted 1073
12 SASI_Hs01_00111957 predicted 293
13 SASI_Hs01_00111960 predicted 851
14 SASI_Hs01_00111963 predicted 365
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080740
ZNF280A MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 280A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080740.3-999s1c1
Sequence:CCGGGCCTGGCAATGACAGACATTTCTCGAGAAATGTCTGTCATTGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080740.3-1830s1c1
Sequence:CCGGCGGCTATGAACACTAGAGATTCTCGAGAATCTCTAGTGTTCATAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080740.3-594s1c1
Sequence:CCGGCTGTCACTATGAAGTCTTCATCTCGAGATGAAGACTTCATAGTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080740.3-1665s1c1
Sequence:CCGGCCAAGGACCATCAAACATTTACTCGAGTAAATGTTTGATGGTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080740.3-519s1c1
Sequence:CCGGCTGCAAATCATGTGACCTCTACTCGAGTAGAGGTCACATGATTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080740.3-1556s1c1
Sequence:CCGGGCAATACCATACATGAATCATCTCGAGATGATTCATGTATGGTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080740.3-726s1c1
Sequence:CCGGGAAATGAGAGTTCTCCTGATTCTCGAGAATCAGGAGAACTCTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080740.3-290s1c1
Sequence:CCGGCCAAAGAAGAATTTGAGAGAACTCGAGTTCTCTCAAATTCTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080740
ZNF280A MISSION shRNA shRNA Plasmid DNA
zinc finger protein 280A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080740.3-999s1c1
Sequence:CCGGGCCTGGCAATGACAGACATTTCTCGAGAAATGTCTGTCATTGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080740.3-1830s1c1
Sequence:CCGGCGGCTATGAACACTAGAGATTCTCGAGAATCTCTAGTGTTCATAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080740.3-594s1c1
Sequence:CCGGCTGTCACTATGAAGTCTTCATCTCGAGATGAAGACTTCATAGTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080740.3-1665s1c1
Sequence:CCGGCCAAGGACCATCAAACATTTACTCGAGTAAATGTTTGATGGTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080740.3-519s1c1
Sequence:CCGGCTGCAAATCATGTGACCTCTACTCGAGTAGAGGTCACATGATTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080740.3-1556s1c1
Sequence:CCGGGCAATACCATACATGAATCATCTCGAGATGATTCATGTATGGTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080740.3-726s1c1
Sequence:CCGGGAAATGAGAGTTCTCCTGATTCTCGAGAATCAGGAGAACTCTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080740.3-290s1c1
Sequence:CCGGCCAAAGAAGAATTTGAGAGAACTCGAGTTCTCTCAAATTCTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080740
ZNF280A MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 280A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080740.3-999s1c1
Sequence:CCGGGCCTGGCAATGACAGACATTTCTCGAGAAATGTCTGTCATTGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080740.3-1830s1c1
Sequence:CCGGCGGCTATGAACACTAGAGATTCTCGAGAATCTCTAGTGTTCATAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080740.3-594s1c1
Sequence:CCGGCTGTCACTATGAAGTCTTCATCTCGAGATGAAGACTTCATAGTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080740.3-1665s1c1
Sequence:CCGGCCAAGGACCATCAAACATTTACTCGAGTAAATGTTTGATGGTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080740.3-519s1c1
Sequence:CCGGCTGCAAATCATGTGACCTCTACTCGAGTAGAGGTCACATGATTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080740.3-1556s1c1
Sequence:CCGGGCAATACCATACATGAATCATCTCGAGATGATTCATGTATGGTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080740.3-726s1c1
Sequence:CCGGGAAATGAGAGTTCTCCTGATTCTCGAGAATCAGGAGAACTCTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080740.3-290s1c1
Sequence:CCGGCCAAAGAAGAATTTGAGAGAACTCGAGTTCTCTCAAATTCTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks