EMAIL THIS PAGE TO A FRIEND

ZNF280B

zinc finger protein 280B

Synonyms: 5'OY11.1 D87009.C22.3 SUHW2 ZNF279 ZNF632
UniProtKB ID: Q86YH2
Gene ID:
Human(140883) Summary: This gene was identified by homology to other species. Its encoded protein is approximately 78-88% identical to a predicted sheep protein of unknown function. The protein is also approximately 25% identical to the Drosophila protein suppressor of hairy wing, which is a leucine zipper protein that represses the function of transcriptional enhancers of the gypsy retrotransposon. [provided by RefSeq, Jul 2008]
domestic guinea pig(100732242) zinc finger protein 280B
naked mole-rat(101712822) zinc finger protein 280B
cow(768254) zinc finger protein 280B
sheep(101118053) zinc finger protein 280B
cow(517697) zinc finger protein 280B
dog(100688572) zinc finger protein 280B
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080764 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080764 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080764 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152531 MISSION® esiRNA esiRNA human ZNF280B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080764 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080764 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045968 predicted 2108
2 SASI_Hs01_00045969 predicted 1615
3 SASI_Hs01_00045970 predicted 1250
4 SASI_Hs01_00045971 predicted 1285
5 SASI_Hs01_00045972 predicted 1245
6 SASI_Hs01_00045973 predicted 1298
7 SASI_Hs01_00045974 predicted 1089
8 SASI_Hs01_00045975 predicted 1164
9 SASI_Hs01_00045976 predicted 1113
10 SASI_Hs02_00362557 predicted 1384
11 SASI_Hs01_00045977 predicted 1182
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080764
ZNF280B MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 280B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080764.2-1023s1c1
Sequence:CCGGGCTCGCAAATTGCAGCCTAAACTCGAGTTTAGGCTGCAATTTGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080764.2-1426s1c1
Sequence:CCGGCACCCTCAAATAATGTTCATACTCGAGTATGAACATTATTTGAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080764.2-1206s1c1
Sequence:CCGGCCTTTGATTACATTCACAGATCTCGAGATCTGTGAATGTAATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080764.2-4065s1c1
Sequence:CCGGGCAAGAAATGTCTCTCTAATTCTCGAGAATTAGAGAGACATTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080764.2-2215s1c1
Sequence:CCGGCCCAGTGTCATCAAATGTTTACTCGAGTAAACATTTGATGACACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080764.2-1252s1c1
Sequence:CCGGCACTTTCAGTAGGAGGTATAACTCGAGTTATACCTCCTACTGAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080764.2-4631s1c1
Sequence:CCGGCGGACACTCATTTGATTGATTCTCGAGAATCAATCAAATGAGTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080764.2-1090s1c1
Sequence:CCGGCCCAACTTGAATCGAGATCAACTCGAGTTGATCTCGATTCAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080764.2-2317s1c1
Sequence:CCGGCAGTGGATGTAGCATCCATAACTCGAGTTATGGATGCTACATCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080764.2-1087s1c1
Sequence:CCGGCTTCCCAACTTGAATCGAGATCTCGAGATCTCGATTCAAGTTGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080764
ZNF280B MISSION shRNA shRNA Plasmid DNA
zinc finger protein 280B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080764.2-1023s1c1
Sequence:CCGGGCTCGCAAATTGCAGCCTAAACTCGAGTTTAGGCTGCAATTTGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080764.2-1426s1c1
Sequence:CCGGCACCCTCAAATAATGTTCATACTCGAGTATGAACATTATTTGAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080764.2-1206s1c1
Sequence:CCGGCCTTTGATTACATTCACAGATCTCGAGATCTGTGAATGTAATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080764.2-4065s1c1
Sequence:CCGGGCAAGAAATGTCTCTCTAATTCTCGAGAATTAGAGAGACATTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080764.2-2215s1c1
Sequence:CCGGCCCAGTGTCATCAAATGTTTACTCGAGTAAACATTTGATGACACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080764.2-1252s1c1
Sequence:CCGGCACTTTCAGTAGGAGGTATAACTCGAGTTATACCTCCTACTGAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080764.2-4631s1c1
Sequence:CCGGCGGACACTCATTTGATTGATTCTCGAGAATCAATCAAATGAGTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080764.2-1090s1c1
Sequence:CCGGCCCAACTTGAATCGAGATCAACTCGAGTTGATCTCGATTCAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080764.2-2317s1c1
Sequence:CCGGCAGTGGATGTAGCATCCATAACTCGAGTTATGGATGCTACATCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080764.2-1087s1c1
Sequence:CCGGCTTCCCAACTTGAATCGAGATCTCGAGATCTCGATTCAAGTTGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080764
ZNF280B MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 280B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080764.2-1023s1c1
Sequence:CCGGGCTCGCAAATTGCAGCCTAAACTCGAGTTTAGGCTGCAATTTGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080764.2-1426s1c1
Sequence:CCGGCACCCTCAAATAATGTTCATACTCGAGTATGAACATTATTTGAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080764.2-1206s1c1
Sequence:CCGGCCTTTGATTACATTCACAGATCTCGAGATCTGTGAATGTAATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080764.2-4065s1c1
Sequence:CCGGGCAAGAAATGTCTCTCTAATTCTCGAGAATTAGAGAGACATTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080764.2-2215s1c1
Sequence:CCGGCCCAGTGTCATCAAATGTTTACTCGAGTAAACATTTGATGACACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080764.2-1252s1c1
Sequence:CCGGCACTTTCAGTAGGAGGTATAACTCGAGTTATACCTCCTACTGAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080764.2-4631s1c1
Sequence:CCGGCGGACACTCATTTGATTGATTCTCGAGAATCAATCAAATGAGTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080764.2-1090s1c1
Sequence:CCGGCCCAACTTGAATCGAGATCAACTCGAGTTGATCTCGATTCAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080764.2-2317s1c1
Sequence:CCGGCAGTGGATGTAGCATCCATAACTCGAGTTATGGATGCTACATCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080764.2-1087s1c1
Sequence:CCGGCTTCCCAACTTGAATCGAGATCTCGAGATCTCGATTCAAGTTGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks