EMAIL THIS PAGE TO A FRIEND

ZNF280C

zinc finger protein 280C

Synonyms: SUHW3 ZNF633
UniProtKB ID: Q8ND82, A8K2V8, Q9NXR3
Gene ID:
Human(55609) Summary: This gene encodes a member of the zinc finger domain-containing protein family. This family member contains multiple Cys2-His2(C2H2)-type zinc finger domains, the most common type of zinc finger domain that self-folds to form a beta-beta-alpha structure that binds a zinc ion. [provided by RefSeq, Aug 2011]
dog(481049) zinc finger protein 280C
Horse(100058803) zinc finger protein 280C
domestic cat(101090750) zinc finger protein 280C
cow(785820) zinc finger protein 280C
sheep(101104049) zinc finger protein 280C
naked mole-rat(101700487) zinc finger protein 280C
domestic guinea pig(100734591) zinc finger protein 280C
130 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017666 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017666 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017666 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU067691 MISSION® esiRNA esiRNA human ZNF280C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017666 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136147 predicted 781
2 SASI_Hs01_00136148 predicted 1390
3 SASI_Hs02_00350390 predicted 729
4 SASI_Hs01_00136149 predicted 2008
5 SASI_Hs01_00136150 predicted 611
6 SASI_Hs01_00136151 predicted 1892
7 SASI_Hs01_00136152 predicted 1025
8 SASI_Hs01_00136153 predicted 1625
9 SASI_Hs02_00350391 predicted 758
10 SASI_Hs01_00136156 predicted 2382
11 SASI_Hs01_00136154 predicted 1087
12 SASI_Hs01_00136155 predicted 481
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017666
VALIDATED
ZNF280C MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 280C
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017666.2-740s1c1
Sequence:CCGGCCTCAGATAAATCCCTCCACTCTCGAGAGTGGAGGGATTTATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017666.2-2245s1c1
Sequence:CCGGCGGCTTAGATCGTATGGCTAACTCGAGTTAGCCATACGATCTAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017666.2-1969s1c1
Sequence:CCGGGAGCCTTGCTTTGAAGAACATCTCGAGATGTTCTTCAAAGCAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_017666.2-4464s1c1
Sequence:CCGGGCACTTGTTTCTTGCTCATATCTCGAGATATGAGCAAGAAACAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017666.2-468s1c1
Sequence:CCGGCGCCTAGATTTCATCTTGTATCTCGAGATACAAGATGAAATCTAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017666.2-1622s1c1
Sequence:CCGGGCGCAGCATCGTACATTTATACTCGAGTATAAATGTACGATGCTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017666.2-796s1c1
Sequence:CCGGCTCCCAAGTTATGCTGTCAAACTCGAGTTTGACAGCATAACTTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017666.3-2477s21c1
Sequence:CCGGTTATGACACTAGCTCTCATTACTCGAGTAATGAGAGCTAGTGTCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017666.3-1409s21c1
Sequence:CCGGCAGTTTAGATCATCAACATTTCTCGAGAAATGTTGATGATCTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017666.3-552s21c1
Sequence:CCGGCACAAGTTGGATCGGATAATTCTCGAGAATTATCCGATCCAACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017666.3-512s21c1
Sequence:CCGGACTGTTGAGAATGCGTCTAAACTCGAGTTTAGACGCATTCTCAACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017666.3-1221s21c1
Sequence:CCGGAGCACTGTTACCGGCAATATCCTCGAGGATATTGCCGGTAACAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017666.3-1112s21c1
Sequence:CCGGAGTTGCTCGAAAGTTCTTAAACTCGAGTTTAAGAACTTTCGAGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017666.3-2634s21c1
Sequence:CCGGTGACTTGCCTTCAGAATATTACTCGAGTAATATTCTGAAGGCAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017666
VALIDATED
ZNF280C MISSION shRNA shRNA Plasmid DNA
zinc finger protein 280C
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017666.2-740s1c1
Sequence:CCGGCCTCAGATAAATCCCTCCACTCTCGAGAGTGGAGGGATTTATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017666.2-2245s1c1
Sequence:CCGGCGGCTTAGATCGTATGGCTAACTCGAGTTAGCCATACGATCTAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017666.2-1969s1c1
Sequence:CCGGGAGCCTTGCTTTGAAGAACATCTCGAGATGTTCTTCAAAGCAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_017666.2-4464s1c1
Sequence:CCGGGCACTTGTTTCTTGCTCATATCTCGAGATATGAGCAAGAAACAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017666.2-468s1c1
Sequence:CCGGCGCCTAGATTTCATCTTGTATCTCGAGATACAAGATGAAATCTAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017666.2-1622s1c1
Sequence:CCGGGCGCAGCATCGTACATTTATACTCGAGTATAAATGTACGATGCTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017666.2-796s1c1
Sequence:CCGGCTCCCAAGTTATGCTGTCAAACTCGAGTTTGACAGCATAACTTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017666.3-2477s21c1
Sequence:CCGGTTATGACACTAGCTCTCATTACTCGAGTAATGAGAGCTAGTGTCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017666.3-1409s21c1
Sequence:CCGGCAGTTTAGATCATCAACATTTCTCGAGAAATGTTGATGATCTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017666.3-552s21c1
Sequence:CCGGCACAAGTTGGATCGGATAATTCTCGAGAATTATCCGATCCAACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017666.3-512s21c1
Sequence:CCGGACTGTTGAGAATGCGTCTAAACTCGAGTTTAGACGCATTCTCAACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017666.3-1221s21c1
Sequence:CCGGAGCACTGTTACCGGCAATATCCTCGAGGATATTGCCGGTAACAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017666.3-1112s21c1
Sequence:CCGGAGTTGCTCGAAAGTTCTTAAACTCGAGTTTAAGAACTTTCGAGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017666.3-2634s21c1
Sequence:CCGGTGACTTGCCTTCAGAATATTACTCGAGTAATATTCTGAAGGCAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017666
VALIDATED
ZNF280C MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 280C
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017666.2-740s1c1
Sequence:CCGGCCTCAGATAAATCCCTCCACTCTCGAGAGTGGAGGGATTTATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017666.2-2245s1c1
Sequence:CCGGCGGCTTAGATCGTATGGCTAACTCGAGTTAGCCATACGATCTAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017666.2-1969s1c1
Sequence:CCGGGAGCCTTGCTTTGAAGAACATCTCGAGATGTTCTTCAAAGCAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_017666.2-4464s1c1
Sequence:CCGGGCACTTGTTTCTTGCTCATATCTCGAGATATGAGCAAGAAACAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017666.2-468s1c1
Sequence:CCGGCGCCTAGATTTCATCTTGTATCTCGAGATACAAGATGAAATCTAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017666.2-1622s1c1
Sequence:CCGGGCGCAGCATCGTACATTTATACTCGAGTATAAATGTACGATGCTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017666.2-796s1c1
Sequence:CCGGCTCCCAAGTTATGCTGTCAAACTCGAGTTTGACAGCATAACTTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017666.3-2477s21c1
Sequence:CCGGTTATGACACTAGCTCTCATTACTCGAGTAATGAGAGCTAGTGTCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017666.3-1409s21c1
Sequence:CCGGCAGTTTAGATCATCAACATTTCTCGAGAAATGTTGATGATCTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017666.3-552s21c1
Sequence:CCGGCACAAGTTGGATCGGATAATTCTCGAGAATTATCCGATCCAACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017666.3-512s21c1
Sequence:CCGGACTGTTGAGAATGCGTCTAAACTCGAGTTTAGACGCATTCTCAACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017666.3-1221s21c1
Sequence:CCGGAGCACTGTTACCGGCAATATCCTCGAGGATATTGCCGGTAACAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017666.3-1112s21c1
Sequence:CCGGAGTTGCTCGAAAGTTCTTAAACTCGAGTTTAAGAACTTTCGAGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017666.3-2634s21c1
Sequence:CCGGTGACTTGCCTTCAGAATATTACTCGAGTAATATTCTGAAGGCAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks