EMAIL THIS PAGE TO A FRIEND

ZNF280D

zinc finger protein 280D

Synonyms: SUHW4 ZNF634
Gene ID:
domestic guinea pig(100716502) zinc finger protein 280D
naked mole-rat(101704381) zinc finger protein 280D
Domestic Rabbit(100345706) zinc finger protein 280D
cow(617261) zinc finger protein 280D
sheep(101120087) zinc finger protein 280D
Zebrafish(556610) zinc finger protein 280D
Horse(100054593) zinc finger protein 280D
domestic cat(101089270) zinc finger protein 280D
dog(478315) zinc finger protein 280D
chicken(415593) zinc finger protein 280D
124 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002843 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002843 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002843 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU080721 MISSION® esiRNA esiRNA human ZNF280D (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002843 Rosetta Predictions human pricing
NM_001002844 Rosetta Predictions human pricing
NM_017661 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304227 predicted 386
2 SASI_Hs01_00241691 predicted 2790
3 SASI_Hs01_00241692 predicted 3038
4 SASI_Hs01_00241693 predicted 2839
5 SASI_Hs01_00241695 predicted 2308
6 SASI_Hs01_00241696 predicted 1622
7 SASI_Hs01_00241697 predicted 1719
8 SASI_Hs02_00304228 predicted 2313
9 SASI_Hs01_00241699 predicted 1984
10 SASI_Hs01_00241700 predicted 1939
11 SASI_Hs01_00241694 predicted 570
12 SASI_Hs01_00241698 predicted 2388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002844 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218601 predicted 674
2 SASI_Hs02_00304229 predicted 446
3 SASI_Hs01_00218602 predicted 770
4 SASI_Hs01_00218603 predicted 617
5 SASI_Hs02_00304230 predicted 476
6 SASI_Hs01_00218605 predicted 330
7 SASI_Hs01_00218606 predicted 463
8 SASI_Hs01_00218607 predicted 443
9 SASI_Hs01_00218608 predicted 536
10 SASI_Hs01_00218609 predicted 549
11 SASI_Hs01_00218604 predicted 451
12 SASI_Hs01_00218610 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350378 predicted 451
2 SASI_Hs01_00170443 predicted 2860
3 SASI_Hs01_00170444 predicted 3101
4 SASI_Hs01_00170445 predicted 2908
5 SASI_Hs01_00170447 predicted 2377
6 SASI_Hs01_00170448 predicted 1691
7 SASI_Hs01_00170449 predicted 1792
8 SASI_Hs02_00350379 predicted 2382
9 SASI_Hs01_00170451 predicted 2045
10 SASI_Hs01_00170452 predicted 2006
11 SASI_Hs01_00170446 predicted 646
12 SASI_Hs01_00170450 predicted 2457
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002843
VALIDATED
ZNF280D MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 280D
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001002843.1-3050s1c1
Sequence:CCGGGCAACAGTAGACCTGGAAGATCTCGAGATCTTCCAGGTCTACTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002843.1-2855s1c1
Sequence:CCGGCCTGAATCTGTTAGTTCTGATCTCGAGATCAGAACTAACAGATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001002843.1-1857s1c1
Sequence:CCGGCCAACGCAAGTAAACCTAATACTCGAGTATTAGGTTTACTTGCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002843.1-3932s1c1
Sequence:CCGGCCTTAGAAATAGGCCCATAAACTCGAGTTTATGGGCCTATTTCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001002843.1-2617s1c1
Sequence:CCGGCATCGTCAGTTGTGATTCAAACTCGAGTTTGAATCACAACTGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_001002843.1-2142s1c1
Sequence:CCGGGCTTTCATAGTAACCGTCCAACTCGAGTTGGACGGTTACTATGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002843.1-869s1c1
Sequence:CCGGGCTTGTCCAAAGTGCAACATTCTCGAGAATGTTGCACTTTGGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002843.1-2025s1c1
Sequence:CCGGGCATTGAGTGTTGTTCCGAAACTCGAGTTTCGGAACAACACTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_001002843.1-3877s1c1
Sequence:CCGGCCCATTGTTGAAACTCCTGTACTCGAGTACAGGAGTTTCAACAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002843
VALIDATED
ZNF280D MISSION shRNA shRNA Plasmid DNA
zinc finger protein 280D
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001002843.1-3050s1c1
Sequence:CCGGGCAACAGTAGACCTGGAAGATCTCGAGATCTTCCAGGTCTACTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002843.1-2855s1c1
Sequence:CCGGCCTGAATCTGTTAGTTCTGATCTCGAGATCAGAACTAACAGATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001002843.1-1857s1c1
Sequence:CCGGCCAACGCAAGTAAACCTAATACTCGAGTATTAGGTTTACTTGCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002843.1-3932s1c1
Sequence:CCGGCCTTAGAAATAGGCCCATAAACTCGAGTTTATGGGCCTATTTCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001002843.1-2617s1c1
Sequence:CCGGCATCGTCAGTTGTGATTCAAACTCGAGTTTGAATCACAACTGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_001002843.1-2142s1c1
Sequence:CCGGGCTTTCATAGTAACCGTCCAACTCGAGTTGGACGGTTACTATGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002843.1-869s1c1
Sequence:CCGGGCTTGTCCAAAGTGCAACATTCTCGAGAATGTTGCACTTTGGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002843.1-2025s1c1
Sequence:CCGGGCATTGAGTGTTGTTCCGAAACTCGAGTTTCGGAACAACACTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_001002843.1-3877s1c1
Sequence:CCGGCCCATTGTTGAAACTCCTGTACTCGAGTACAGGAGTTTCAACAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002843
VALIDATED
ZNF280D MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 280D
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001002843.1-3050s1c1
Sequence:CCGGGCAACAGTAGACCTGGAAGATCTCGAGATCTTCCAGGTCTACTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002843.1-2855s1c1
Sequence:CCGGCCTGAATCTGTTAGTTCTGATCTCGAGATCAGAACTAACAGATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001002843.1-1857s1c1
Sequence:CCGGCCAACGCAAGTAAACCTAATACTCGAGTATTAGGTTTACTTGCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002843.1-3932s1c1
Sequence:CCGGCCTTAGAAATAGGCCCATAAACTCGAGTTTATGGGCCTATTTCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001002843.1-2617s1c1
Sequence:CCGGCATCGTCAGTTGTGATTCAAACTCGAGTTTGAATCACAACTGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_001002843.1-2142s1c1
Sequence:CCGGGCTTTCATAGTAACCGTCCAACTCGAGTTGGACGGTTACTATGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002843.1-869s1c1
Sequence:CCGGGCTTGTCCAAAGTGCAACATTCTCGAGAATGTTGCACTTTGGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002843.1-2025s1c1
Sequence:CCGGGCATTGAGTGTTGTTCCGAAACTCGAGTTTCGGAACAACACTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_001002843.1-3877s1c1
Sequence:CCGGCCCATTGTTGAAACTCCTGTACTCGAGTACAGGAGTTTCAACAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks