EMAIL THIS PAGE TO A FRIEND

ZNF281

zinc finger protein 281

Synonyms: ZBP-99 ZNP-99
UniProtKB ID: Q9Y2X9, B3KMX2, Q5RKW5, Q9NY92
Gene ID:
chicken(101667372) zinc finger protein 281
dog(490250) zinc finger protein 281
domestic cat(101094474) zinc finger protein 281
chicken(101749232) zinc finger protein 281
cow(532401) zinc finger protein 281
sheep(101103168) zinc finger protein 281
naked mole-rat(101708488) zinc finger protein 281
domestic guinea pig(100736136) zinc finger protein 281
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012482 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012482 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012482 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001591 MISSION® esiRNA esiRNA targeting human ZNF281 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012482 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029621 predicted 2458
2 SASI_Hs01_00029622 predicted 1145
3 SASI_Hs01_00029623 predicted 2574
4 SASI_Hs02_00344395 predicted 1543
5 SASI_Hs02_00344396 predicted 1449
6 SASI_Hs01_00029625 predicted 782
7 SASI_Hs01_00029626 predicted 1601
8 SASI_Hs01_00029627 predicted 2717
9 SASI_Hs01_00029628 predicted 1834
10 SASI_Hs01_00029629 predicted 924
11 SASI_Hs01_00029620 predicted 889
12 SASI_Hs01_00029624 predicted 1450
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012482
ZNF281 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 281
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012482.3-2747s1c1
Sequence:CCGGGCCATGTAGTACAAGAGTAAACTCGAGTTTACTCTTGTACTACATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012482.3-1409s1c1
Sequence:CCGGGCAGAGTTACTCAGTAGAAATCTCGAGATTTCTACTGAGTAACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012482.3-1566s1c1
Sequence:CCGGCCAGACATAGTAGGACAGAAACTCGAGTTTCTGTCCTACTATGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012482.3-248s1c1
Sequence:CCGGCCAGGGTATGGTTATGTTCAACTCGAGTTGAACATAACCATACCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012482.3-2570s1c1
Sequence:CCGGGCCTAGAACAACGTATCAGATCTCGAGATCTGATACGTTGTTCTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012482.3-3216s21c1
Sequence:CCGGGTAATGGAATATCCAATTTACCTCGAGGTAAATTGGATATTCCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012482.3-1205s21c1
Sequence:CCGGATGTGGTGAAGTCATAGTTAACTCGAGTTAACTATGACTTCACCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012482.3-3137s21c1
Sequence:CCGGTTGCTAGGATTAAGGTTATTCCTCGAGGAATAACCTTAATCCTAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012482
ZNF281 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 281
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012482.3-2747s1c1
Sequence:CCGGGCCATGTAGTACAAGAGTAAACTCGAGTTTACTCTTGTACTACATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012482.3-1409s1c1
Sequence:CCGGGCAGAGTTACTCAGTAGAAATCTCGAGATTTCTACTGAGTAACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012482.3-1566s1c1
Sequence:CCGGCCAGACATAGTAGGACAGAAACTCGAGTTTCTGTCCTACTATGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012482.3-248s1c1
Sequence:CCGGCCAGGGTATGGTTATGTTCAACTCGAGTTGAACATAACCATACCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012482.3-2570s1c1
Sequence:CCGGGCCTAGAACAACGTATCAGATCTCGAGATCTGATACGTTGTTCTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012482.3-3216s21c1
Sequence:CCGGGTAATGGAATATCCAATTTACCTCGAGGTAAATTGGATATTCCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012482.3-1205s21c1
Sequence:CCGGATGTGGTGAAGTCATAGTTAACTCGAGTTAACTATGACTTCACCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012482.3-3137s21c1
Sequence:CCGGTTGCTAGGATTAAGGTTATTCCTCGAGGAATAACCTTAATCCTAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012482
ZNF281 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 281
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012482.3-2747s1c1
Sequence:CCGGGCCATGTAGTACAAGAGTAAACTCGAGTTTACTCTTGTACTACATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012482.3-1409s1c1
Sequence:CCGGGCAGAGTTACTCAGTAGAAATCTCGAGATTTCTACTGAGTAACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012482.3-1566s1c1
Sequence:CCGGCCAGACATAGTAGGACAGAAACTCGAGTTTCTGTCCTACTATGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012482.3-248s1c1
Sequence:CCGGCCAGGGTATGGTTATGTTCAACTCGAGTTGAACATAACCATACCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012482.3-2570s1c1
Sequence:CCGGGCCTAGAACAACGTATCAGATCTCGAGATCTGATACGTTGTTCTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012482.3-3216s21c1
Sequence:CCGGGTAATGGAATATCCAATTTACCTCGAGGTAAATTGGATATTCCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012482.3-1205s21c1
Sequence:CCGGATGTGGTGAAGTCATAGTTAACTCGAGTTAACTATGACTTCACCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012482.3-3137s21c1
Sequence:CCGGTTGCTAGGATTAAGGTTATTCCTCGAGGAATAACCTTAATCCTAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks