EMAIL THIS PAGE TO A FRIEND

ZNF282

zinc finger protein 282

Synonyms: HUB1
UniProtKB ID: Q9UDV7, O43691, Q6DKK0
Gene ID:
domestic guinea pig(100717298) zinc finger protein 282
naked mole-rat(101699057) zinc finger protein 282
cow(101906118) zinc finger protein 282
cow(527558) zinc finger protein 282
sheep(101107593) zinc finger protein 282
dog(100686177) zinc finger protein 282
domestic cat(101089342) zinc finger protein 282
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV38360 Anti-ZNF282 (AB1) antibody produced in rabbit IgG fraction of antiserum guinea pig, mouse, rat, human, canine, bovine, rabbit
western blot pricing
AV38361 Anti-ZNF282 (AB2) antibody produced in rabbit IgG fraction of antiserum mouse, horse, canine, human, rabbit, zebrafish, rat, bovine, guinea pig
western blot pricing
HPA024374 Anti-ZNF282 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003575 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003575 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003575 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003575 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062542 predicted 526
2 SASI_Hs01_00062543 predicted 1035
3 SASI_Hs01_00062544 predicted 767
4 SASI_Hs01_00062545 predicted 1840
5 SASI_Hs01_00062546 predicted 393
6 SASI_Hs01_00062547 predicted 1028
7 SASI_Hs02_00335882 predicted 1079
8 SASI_Hs01_00062548 predicted 772
9 SASI_Hs01_00062549 predicted 908
10 SASI_Hs02_00335883 predicted 2294
11 SASI_Hs01_00062550 predicted 742
12 SASI_Hs01_00062551 predicted 787
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003575
VALIDATED
ZNF282 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 282
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003575.2-1117s21c1
Sequence:CCGGGTGTGGGATCAGCAGGATTTGCTCGAGCAAATCCTGCTGATCCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003575.2-1148s21c1
Sequence:CCGGATATTCCCACGGATCCCAATTCTCGAGAATTGGGATCCGTGGGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003575.2-752s21c1
Sequence:CCGGACGAATGGCAGAAGGAGCTTTCTCGAGAAAGCTCCTTCTGCCATTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003575.2-2273s21c1
Sequence:CCGGCAGATCTGTCTGGTCTGAATGCTCGAGCATTCAGACCAGACAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003575.2-1252s21c1
Sequence:CCGGATGGACGGAGAGCTTGGATTACTCGAGTAATCCAAGCTCTCCGTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003575.1-3094s1c1
Sequence:CCGGCCATGATGATTTGTTCCAGTTCTCGAGAACTGGAACAAATCATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003575.1-1056s1c1
Sequence:CCGGGCCATCCCTACGGAATCCATTCTCGAGAATGGATTCCGTAGGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003575.1-930s1c1
Sequence:CCGGGAGAGAGAAATCCCAATGGATCTCGAGATCCATTGGGATTTCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003575.1-752s1c1
Sequence:CCGGCGAAGACGAGTGGAAGAACTTCTCGAGAAGTTCTTCCACTCGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003575.1-1113s1c1
Sequence:CCGGCGGATTAAACAGGAGGAGCATCTCGAGATGCTCCTCCTGTTTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003575
VALIDATED
ZNF282 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 282
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003575.2-1117s21c1
Sequence:CCGGGTGTGGGATCAGCAGGATTTGCTCGAGCAAATCCTGCTGATCCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003575.2-1148s21c1
Sequence:CCGGATATTCCCACGGATCCCAATTCTCGAGAATTGGGATCCGTGGGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003575.2-752s21c1
Sequence:CCGGACGAATGGCAGAAGGAGCTTTCTCGAGAAAGCTCCTTCTGCCATTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003575.2-2273s21c1
Sequence:CCGGCAGATCTGTCTGGTCTGAATGCTCGAGCATTCAGACCAGACAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003575.2-1252s21c1
Sequence:CCGGATGGACGGAGAGCTTGGATTACTCGAGTAATCCAAGCTCTCCGTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003575.1-3094s1c1
Sequence:CCGGCCATGATGATTTGTTCCAGTTCTCGAGAACTGGAACAAATCATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003575.1-1056s1c1
Sequence:CCGGGCCATCCCTACGGAATCCATTCTCGAGAATGGATTCCGTAGGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003575.1-930s1c1
Sequence:CCGGGAGAGAGAAATCCCAATGGATCTCGAGATCCATTGGGATTTCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003575.1-752s1c1
Sequence:CCGGCGAAGACGAGTGGAAGAACTTCTCGAGAAGTTCTTCCACTCGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003575.1-1113s1c1
Sequence:CCGGCGGATTAAACAGGAGGAGCATCTCGAGATGCTCCTCCTGTTTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003575
VALIDATED
ZNF282 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 282
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003575.2-1117s21c1
Sequence:CCGGGTGTGGGATCAGCAGGATTTGCTCGAGCAAATCCTGCTGATCCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003575.2-1148s21c1
Sequence:CCGGATATTCCCACGGATCCCAATTCTCGAGAATTGGGATCCGTGGGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003575.2-752s21c1
Sequence:CCGGACGAATGGCAGAAGGAGCTTTCTCGAGAAAGCTCCTTCTGCCATTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003575.2-2273s21c1
Sequence:CCGGCAGATCTGTCTGGTCTGAATGCTCGAGCATTCAGACCAGACAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003575.2-1252s21c1
Sequence:CCGGATGGACGGAGAGCTTGGATTACTCGAGTAATCCAAGCTCTCCGTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003575.1-3094s1c1
Sequence:CCGGCCATGATGATTTGTTCCAGTTCTCGAGAACTGGAACAAATCATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003575.1-1056s1c1
Sequence:CCGGGCCATCCCTACGGAATCCATTCTCGAGAATGGATTCCGTAGGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003575.1-930s1c1
Sequence:CCGGGAGAGAGAAATCCCAATGGATCTCGAGATCCATTGGGATTTCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003575.1-752s1c1
Sequence:CCGGCGAAGACGAGTGGAAGAACTTCTCGAGAAGTTCTTCCACTCGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003575.1-1113s1c1
Sequence:CCGGCGGATTAAACAGGAGGAGCATCTCGAGATGCTCCTCCTGTTTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks