EMAIL THIS PAGE TO A FRIEND

ZNF283

zinc finger protein 283

Synonyms: HZF41
UniProtKB ID: Q8N7M2, B4DGZ5, B7WP04, Q6RFR9, Q86WM6
Gene ID:
domestic cat(101100265) zinc finger protein 283
dog(613011) zinc finger protein 283
cow(517970) zinc finger protein 283
sheep(101109117) zinc finger protein 283
34 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181845 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181845 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181845 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181845 Rosetta Predictions human pricing
XM_371174 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370434 predicted 2250
2 SASI_Hs02_00370435 predicted 2166
3 SASI_Hs02_00370436 predicted 2337
4 SASI_Hs02_00370437 predicted 1082
5 SASI_Hs02_00370438 predicted 785
6 SASI_Hs02_00370439 predicted 839
7 SASI_Hs02_00370440 predicted 977
8 SASI_Hs02_00370441 predicted 1006
9 SASI_Hs02_00370442 predicted 766
10 SASI_Hs02_00370443 predicted 2093
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261878 predicted 2470
2 SASI_Hs01_00261879 predicted 1225
3 SASI_Hs01_00261880 predicted 241
4 SASI_Hs01_00261881 predicted 520
5 SASI_Hs01_00261882 predicted 926
6 SASI_Hs01_00261883 predicted 2417
7 SASI_Hs01_00261884 predicted 573
8 SASI_Hs01_00261885 predicted 1115
9 SASI_Hs01_00261886 predicted 1733
10 SASI_Hs01_00261887 predicted 1138
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181845
ZNF283 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 283
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181845.1-2364s21c1
Sequence:CCGGGAACTCTTACTCTTGAGAAACCTCGAGGTTTCTCAAGAGTAAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181845.1-2258s21c1
Sequence:CCGGCTGTGGACAACTTACTCAAATCTCGAGATTTGAGTAAGTTGTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181845.1-2214s21c1
Sequence:CCGGGTAATGATAAACCCTACAAATCTCGAGATTTGTAGGGTTTATCATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181845.1-2033s21c1
Sequence:CCGGCATGAGAGAGTCCATACTAATCTCGAGATTAGTATGGACTCTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181845.1-1504s21c1
Sequence:CCGGTAATTGCGGATCAAGTCTTATCTCGAGATAAGACTTGATCCGCAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181845
ZNF283 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 283
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181845.1-2364s21c1
Sequence:CCGGGAACTCTTACTCTTGAGAAACCTCGAGGTTTCTCAAGAGTAAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181845.1-2258s21c1
Sequence:CCGGCTGTGGACAACTTACTCAAATCTCGAGATTTGAGTAAGTTGTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181845.1-2214s21c1
Sequence:CCGGGTAATGATAAACCCTACAAATCTCGAGATTTGTAGGGTTTATCATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181845.1-2033s21c1
Sequence:CCGGCATGAGAGAGTCCATACTAATCTCGAGATTAGTATGGACTCTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181845.1-1504s21c1
Sequence:CCGGTAATTGCGGATCAAGTCTTATCTCGAGATAAGACTTGATCCGCAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181845
ZNF283 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 283
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181845.1-2364s21c1
Sequence:CCGGGAACTCTTACTCTTGAGAAACCTCGAGGTTTCTCAAGAGTAAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181845.1-2258s21c1
Sequence:CCGGCTGTGGACAACTTACTCAAATCTCGAGATTTGAGTAAGTTGTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181845.1-2214s21c1
Sequence:CCGGGTAATGATAAACCCTACAAATCTCGAGATTTGTAGGGTTTATCATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181845.1-2033s21c1
Sequence:CCGGCATGAGAGAGTCCATACTAATCTCGAGATTAGTATGGACTCTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181845.1-1504s21c1
Sequence:CCGGTAATTGCGGATCAAGTCTTATCTCGAGATAAGACTTGATCCGCAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks