EMAIL THIS PAGE TO A FRIEND

ZNF284

zinc finger protein 284

Synonyms: ZNF284L
Species: Human ZNF284(342909)
UniProtKB ID: Q2VY69, Q86WM1
Gene ID:
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037813 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037813 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037813 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037813 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163524 predicted 742
2 SASI_Hs01_00163525 predicted 1094
3 SASI_Hs01_00163526 predicted 1210
4 SASI_Hs01_00163527 predicted 1478
5 SASI_Hs01_00163528 predicted 620
6 SASI_Hs01_00163529 predicted 825
7 SASI_Hs01_00163530 predicted 1371
8 SASI_Hs01_00163531 predicted 1698
9 SASI_Hs01_00163532 predicted 1165
10 SASI_Hs01_00163533 predicted 1262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037813
ZNF284 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 284
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037813.2-655s21c1
Sequence:CCGGTCTGAGCATGGGAAGTGTAAACTCGAGTTTACACTTCCCATGCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037813.2-2011s21c1
Sequence:CCGGTTTATGGGTTACAGCATATTTCTCGAGAAATATGCTGTAACCCATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037813.2-1272s21c1
Sequence:CCGGCACTTGTAGGCAAGATCTTTGCTCGAGCAAAGATCTTGCCTACAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037813.2-1163s21c1
Sequence:CCGGGATGTGATACCTGTAGTAATACTCGAGTATTACTACAGGTATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037813.2-1480s21c1
Sequence:CCGGAGAGAAGAAGAACTGTATAAACTCGAGTTTATACAGTTCTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037813
ZNF284 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 284
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037813.2-655s21c1
Sequence:CCGGTCTGAGCATGGGAAGTGTAAACTCGAGTTTACACTTCCCATGCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037813.2-2011s21c1
Sequence:CCGGTTTATGGGTTACAGCATATTTCTCGAGAAATATGCTGTAACCCATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037813.2-1272s21c1
Sequence:CCGGCACTTGTAGGCAAGATCTTTGCTCGAGCAAAGATCTTGCCTACAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037813.2-1163s21c1
Sequence:CCGGGATGTGATACCTGTAGTAATACTCGAGTATTACTACAGGTATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037813.2-1480s21c1
Sequence:CCGGAGAGAAGAAGAACTGTATAAACTCGAGTTTATACAGTTCTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037813
ZNF284 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 284
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037813.2-655s21c1
Sequence:CCGGTCTGAGCATGGGAAGTGTAAACTCGAGTTTACACTTCCCATGCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037813.2-2011s21c1
Sequence:CCGGTTTATGGGTTACAGCATATTTCTCGAGAAATATGCTGTAACCCATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037813.2-1272s21c1
Sequence:CCGGCACTTGTAGGCAAGATCTTTGCTCGAGCAAAGATCTTGCCTACAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037813.2-1163s21c1
Sequence:CCGGGATGTGATACCTGTAGTAATACTCGAGTATTACTACAGGTATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037813.2-1480s21c1
Sequence:CCGGAGAGAAGAAGAACTGTATAAACTCGAGTTTATACAGTTCTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks