EMAIL THIS PAGE TO A FRIEND

ZNF285

zinc finger protein 285

Synonyms: ZNF285A
UniProtKB ID: Q96NJ3, Q17RJ3, Q6B0A8, Q6ISR5
Gene ID:
domestic cat(101098020) zinc finger protein 285
dog(100687813) zinc finger protein 285
cow(101903727) zinc finger protein 285
naked mole-rat(101729389) zinc finger protein 285
38 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152354 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152354 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152354 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036591 MISSION® esiRNA esiRNA human ZNF285A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152354 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223177 predicted 1637
2 SASI_Hs01_00223178 predicted 746
3 SASI_Hs01_00223180 predicted 746
4 SASI_Hs01_00223181 predicted 264
5 SASI_Hs02_00365989 predicted 602
6 SASI_Hs01_00223176 predicted 220
7 SASI_Hs02_00365990 predicted 1593
8 SASI_Hs01_00223182 predicted 1661
9 SASI_Hs01_00223175 predicted 410
10 SASI_Hs01_00223179 predicted 1350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152354
ZNF285 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 285
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000015353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152354.2-1642s1c1
Sequence:CCGGCGGAATTCAGATCTTAATGTTCTCGAGAACATTAAGATCTGAATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152354.2-1060s1c1
Sequence:CCGGTCTTCCCTTCACAACCATCATCTCGAGATGATGGTTGTGAAGGGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152354.2-1432s1c1
Sequence:CCGGGAGAAACCATACAAATGCAATCTCGAGATTGCATTTGTATGGTTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152354.2-271s1c1
Sequence:CCGGCTTTCGCAAGAAGTGCTTCATCTCGAGATGAAGCACTTCTTGCGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152354
ZNF285 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 285
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000015353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152354.2-1642s1c1
Sequence:CCGGCGGAATTCAGATCTTAATGTTCTCGAGAACATTAAGATCTGAATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152354.2-1060s1c1
Sequence:CCGGTCTTCCCTTCACAACCATCATCTCGAGATGATGGTTGTGAAGGGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152354.2-1432s1c1
Sequence:CCGGGAGAAACCATACAAATGCAATCTCGAGATTGCATTTGTATGGTTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152354.2-271s1c1
Sequence:CCGGCTTTCGCAAGAAGTGCTTCATCTCGAGATGAAGCACTTCTTGCGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152354
ZNF285 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 285
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000015353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152354.2-1642s1c1
Sequence:CCGGCGGAATTCAGATCTTAATGTTCTCGAGAACATTAAGATCTGAATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152354.2-1060s1c1
Sequence:CCGGTCTTCCCTTCACAACCATCATCTCGAGATGATGGTTGTGAAGGGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152354.2-1432s1c1
Sequence:CCGGGAGAAACCATACAAATGCAATCTCGAGATTGCATTTGTATGGTTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152354.2-271s1c1
Sequence:CCGGCTTTCGCAAGAAGTGCTTCATCTCGAGATGAAGCACTTCTTGCGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks