EMAIL THIS PAGE TO A FRIEND

ZNF286A

zinc finger protein 286A

Synonyms: ZNF286
UniProtKB ID: Q9HBT8, Q96JF3
Gene ID:
dog(608944) zinc finger protein 286A
Horse(100063129) zinc finger protein 286A
domestic cat(101091059) zinc finger protein 286A
domestic guinea pig(100730334) zinc finger protein 286A
cow(789857) zinc finger protein 286A
sheep(101116586) zinc finger protein 286A
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020652 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020652 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020652 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128181 MISSION® esiRNA esiRNA human ZNF286 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020652 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020652 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167008 predicted 674
2 SASI_Hs02_00353630 predicted 1323
3 SASI_Hs01_00167009 predicted 546
4 SASI_Hs01_00167010 predicted 744
5 SASI_Hs01_00167012 predicted 944
6 SASI_Hs01_00167013 predicted 901
7 SASI_Hs01_00167014 predicted 1491
8 SASI_Hs01_00167015 predicted 874
9 SASI_Hs02_00353631 predicted 743
10 SASI_Hs01_00167016 predicted 604
11 SASI_Hs01_00167011 predicted 842
12 SASI_Hs01_00167017 predicted 1072
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020652
ZNF286A MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 286A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020652.1-1014s1c1
Sequence:CCGGGCAGAGAACTTATAAAGAGAACTCGAGTTCTCTTTATAAGTTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020652.1-577s1c1
Sequence:CCGGGAGAGCTACAACTTGGAGAATCTCGAGATTCTCCAAGTTGTAGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020652.1-1157s1c1
Sequence:CCGGGCCACAGAGCTAATTTAACTACTCGAGTAGTTAAATTAGCTCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020652.1-638s1c1
Sequence:CCGGGCAGCTATTCAGACATGGAGACTCGAGTCTCCATGTCTGAATAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020652.1-1740s1c1
Sequence:CCGGCATTCATTCATCAGCTCTCATCTCGAGATGAGAGCTGATGAATGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020652.2-705s21c1
Sequence:CCGGTAGGAACCTAGTCTCACTTTGCTCGAGCAAAGTGAGACTAGGTTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020652.2-774s21c1
Sequence:CCGGACCATTGAAGCTTGAGAGAAACTCGAGTTTCTCTCAAGCTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020652.2-663s21c1
Sequence:CCGGGAAGCTGGATCCTGCACAAAGCTCGAGCTTTGTGCAGGATCCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020652.2-628s21c1
Sequence:CCGGGATGTGGCCATGGACTTTACACTCGAGTGTAAAGTCCATGGCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020652.2-4422s21c1
Sequence:CCGGTTTCGTAATACCGTCAGTTAACTCGAGTTAACTGACGGTATTACGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020652
ZNF286A MISSION shRNA shRNA Plasmid DNA
zinc finger protein 286A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020652.1-1014s1c1
Sequence:CCGGGCAGAGAACTTATAAAGAGAACTCGAGTTCTCTTTATAAGTTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020652.1-577s1c1
Sequence:CCGGGAGAGCTACAACTTGGAGAATCTCGAGATTCTCCAAGTTGTAGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020652.1-1157s1c1
Sequence:CCGGGCCACAGAGCTAATTTAACTACTCGAGTAGTTAAATTAGCTCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020652.1-638s1c1
Sequence:CCGGGCAGCTATTCAGACATGGAGACTCGAGTCTCCATGTCTGAATAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020652.1-1740s1c1
Sequence:CCGGCATTCATTCATCAGCTCTCATCTCGAGATGAGAGCTGATGAATGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020652.2-705s21c1
Sequence:CCGGTAGGAACCTAGTCTCACTTTGCTCGAGCAAAGTGAGACTAGGTTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020652.2-774s21c1
Sequence:CCGGACCATTGAAGCTTGAGAGAAACTCGAGTTTCTCTCAAGCTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020652.2-663s21c1
Sequence:CCGGGAAGCTGGATCCTGCACAAAGCTCGAGCTTTGTGCAGGATCCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020652.2-628s21c1
Sequence:CCGGGATGTGGCCATGGACTTTACACTCGAGTGTAAAGTCCATGGCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020652.2-4422s21c1
Sequence:CCGGTTTCGTAATACCGTCAGTTAACTCGAGTTAACTGACGGTATTACGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020652
ZNF286A MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 286A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020652.1-1014s1c1
Sequence:CCGGGCAGAGAACTTATAAAGAGAACTCGAGTTCTCTTTATAAGTTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020652.1-577s1c1
Sequence:CCGGGAGAGCTACAACTTGGAGAATCTCGAGATTCTCCAAGTTGTAGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020652.1-1157s1c1
Sequence:CCGGGCCACAGAGCTAATTTAACTACTCGAGTAGTTAAATTAGCTCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020652.1-638s1c1
Sequence:CCGGGCAGCTATTCAGACATGGAGACTCGAGTCTCCATGTCTGAATAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020652.1-1740s1c1
Sequence:CCGGCATTCATTCATCAGCTCTCATCTCGAGATGAGAGCTGATGAATGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020652.2-705s21c1
Sequence:CCGGTAGGAACCTAGTCTCACTTTGCTCGAGCAAAGTGAGACTAGGTTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020652.2-774s21c1
Sequence:CCGGACCATTGAAGCTTGAGAGAAACTCGAGTTTCTCTCAAGCTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020652.2-663s21c1
Sequence:CCGGGAAGCTGGATCCTGCACAAAGCTCGAGCTTTGTGCAGGATCCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020652.2-628s21c1
Sequence:CCGGGATGTGGCCATGGACTTTACACTCGAGTGTAAAGTCCATGGCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020652.2-4422s21c1
Sequence:CCGGTTTCGTAATACCGTCAGTTAACTCGAGTTAACTGACGGTATTACGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks