EMAIL THIS PAGE TO A FRIEND

ZNF286B

zinc finger protein 286B

Synonyms: ZNF286C ZNF286L ZNF590
Species: Human ZNF286B(729288)
UniProtKB ID: P0CG31
Gene ID:
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145045 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145045 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145045 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_042343 Rosetta Predictions human pricing
XR_042438 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042343 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00534013 predicted 4360
2 SASI_Hs02_00534014 predicted 1226
3 SASI_Hs02_00534015 predicted 4335
4 SASI_Hs02_00534016 predicted 1397
5 SASI_Hs02_00534017 predicted 3015
6 SASI_Hs02_00534018 predicted 2697
7 SASI_Hs02_00534019 predicted 4158
8 SASI_Hs02_00534020 predicted 2001
9 SASI_Hs02_00534021 predicted 5494
10 SASI_Hs02_00534022 predicted 4900
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00534450 predicted 889
2 SASI_Hs02_00534451 predicted 759
3 SASI_Hs02_00534452 predicted 639
4 SASI_Hs02_00534453 predicted 194
5 SASI_Hs02_00534454 predicted 575
6 SASI_Hs02_00534455 predicted 867
7 SASI_Hs02_00534456 predicted 889
8 SASI_Hs02_00534457 predicted 640
9 SASI_Hs02_00534458 predicted 527
10 SASI_Hs02_00534459 predicted 616
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145045
ZNF286B MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 286B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145045.1-1976s21c1
Sequence:CCGGGGTTCTTTATGTCCGTTAATTCTCGAGAATTAACGGACATAAAGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145045.1-507s21c1
Sequence:CCGGTCATTAACTCTTACCTATTACCTCGAGGTAATAGGTAAGAGTTAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145045.1-455s21c1
Sequence:CCGGGGCGCGAGAGGAGATCAAATCCTCGAGGATTTGATCTCCTCTCGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145045.1-1383s21c1
Sequence:CCGGACTGGAGAGAAACCTTATAAACTCGAGTTTATAAGGTTTCTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145045.1-1213s21c1
Sequence:CCGGACGTTGGAGAGAGACCTTATGCTCGAGCATAAGGTCTCTCTCCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145045
ZNF286B MISSION shRNA shRNA Plasmid DNA
zinc finger protein 286B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145045.1-1976s21c1
Sequence:CCGGGGTTCTTTATGTCCGTTAATTCTCGAGAATTAACGGACATAAAGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145045.1-507s21c1
Sequence:CCGGTCATTAACTCTTACCTATTACCTCGAGGTAATAGGTAAGAGTTAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145045.1-455s21c1
Sequence:CCGGGGCGCGAGAGGAGATCAAATCCTCGAGGATTTGATCTCCTCTCGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145045.1-1383s21c1
Sequence:CCGGACTGGAGAGAAACCTTATAAACTCGAGTTTATAAGGTTTCTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145045.1-1213s21c1
Sequence:CCGGACGTTGGAGAGAGACCTTATGCTCGAGCATAAGGTCTCTCTCCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145045
ZNF286B MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 286B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145045.1-1976s21c1
Sequence:CCGGGGTTCTTTATGTCCGTTAATTCTCGAGAATTAACGGACATAAAGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145045.1-507s21c1
Sequence:CCGGTCATTAACTCTTACCTATTACCTCGAGGTAATAGGTAAGAGTTAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145045.1-455s21c1
Sequence:CCGGGGCGCGAGAGGAGATCAAATCCTCGAGGATTTGATCTCCTCTCGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145045.1-1383s21c1
Sequence:CCGGACTGGAGAGAAACCTTATAAACTCGAGTTTATAAGGTTTCTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145045.1-1213s21c1
Sequence:CCGGACGTTGGAGAGAGACCTTATGCTCGAGCATAAGGTCTCTCTCCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks