EMAIL THIS PAGE TO A FRIEND

ZNF287

zinc finger protein 287

Synonyms: ZKSCAN13 ZSCAN45
UniProtKB ID: Q9HBT7, Q6IAG1
Gene ID:
Human(57336) Summary: This gene encodes a member of the krueppel family of zinc finger proteins, suggesting a role as a transcription factor. Its specific function has not been determined. This gene is located near the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
domestic cat(101093470) zinc finger protein 287
dog(489521) zinc finger protein 287
cow(514947) zinc finger protein 287
sheep(101116328) zinc finger protein 287
domestic guinea pig(100722969) zinc finger protein 287
naked mole-rat(101701376) zinc finger protein 287
Domestic Rabbit(100356391) zinc finger protein 287
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020653 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020653 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020653 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU143851 MISSION® esiRNA esiRNA human ZNF287 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020653 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020653 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098957 predicted 1864
2 SASI_Hs01_00098958 predicted 1792
3 SASI_Hs01_00098959 predicted 2010
4 SASI_Hs01_00098961 predicted 720
5 SASI_Hs02_00353632 predicted 1177
6 SASI_Hs01_00098963 predicted 2116
7 SASI_Hs01_00098964 predicted 1598
8 SASI_Hs01_00098965 predicted 706
9 SASI_Hs02_00353633 predicted 1438
10 SASI_Hs01_00098966 predicted 1307
11 SASI_Hs01_00098960 predicted 1116
12 SASI_Hs01_00098962 predicted 1323
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020653
ZNF287 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 287
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020653.1-864s21c1
Sequence:CCGGTCCAGACAGGATGGCTAAATGCTCGAGCATTTAGCCATCCTGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020653.1-2663s21c1
Sequence:CCGGGGTGCCAAACATCGTAATTAACTCGAGTTAATTACGATGTTTGGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020653.1-1868s21c1
Sequence:CCGGCATAGTTCATCACTGATTAATCTCGAGATTAATCAGTGATGAACTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020653.1-2819s21c1
Sequence:CCGGGGTATGGATATAACCTATTTACTCGAGTAAATAGGTTATATCCATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020653.1-1042s21c1
Sequence:GTACCGGACCAACTGTGATTCCCATATTCTCGAGAATATGGGAATCACAGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020653.1-1542s1c1
Sequence:CCGGCCCTCCTGAAACACCAAAGTACTCGAGTACTTTGGTGTTTCAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020653.1-2594s1c1
Sequence:CCGGGCATGTCGTATATGTGGTAAACTCGAGTTTACCACATATACGACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020653.1-482s1c1
Sequence:CCGGCCCTACAATGTTGAGAAGGAACTCGAGTTCCTTCTCAACATTGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020653.1-2363s1c1
Sequence:CCGGGCATATAGACAAGGCGCAAATCTCGAGATTTGCGCCTTGTCTATATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020653.1-1142s1c1
Sequence:CCGGCCAGTGGAGGATATGTCTAAACTCGAGTTTAGACATATCCTCCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020653
ZNF287 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 287
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020653.1-864s21c1
Sequence:CCGGTCCAGACAGGATGGCTAAATGCTCGAGCATTTAGCCATCCTGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020653.1-2663s21c1
Sequence:CCGGGGTGCCAAACATCGTAATTAACTCGAGTTAATTACGATGTTTGGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020653.1-1868s21c1
Sequence:CCGGCATAGTTCATCACTGATTAATCTCGAGATTAATCAGTGATGAACTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020653.1-2819s21c1
Sequence:CCGGGGTATGGATATAACCTATTTACTCGAGTAAATAGGTTATATCCATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020653.1-1042s21c1
Sequence:GTACCGGACCAACTGTGATTCCCATATTCTCGAGAATATGGGAATCACAGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020653.1-1542s1c1
Sequence:CCGGCCCTCCTGAAACACCAAAGTACTCGAGTACTTTGGTGTTTCAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020653.1-2594s1c1
Sequence:CCGGGCATGTCGTATATGTGGTAAACTCGAGTTTACCACATATACGACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020653.1-482s1c1
Sequence:CCGGCCCTACAATGTTGAGAAGGAACTCGAGTTCCTTCTCAACATTGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020653.1-2363s1c1
Sequence:CCGGGCATATAGACAAGGCGCAAATCTCGAGATTTGCGCCTTGTCTATATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020653.1-1142s1c1
Sequence:CCGGCCAGTGGAGGATATGTCTAAACTCGAGTTTAGACATATCCTCCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020653
ZNF287 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 287
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020653.1-864s21c1
Sequence:CCGGTCCAGACAGGATGGCTAAATGCTCGAGCATTTAGCCATCCTGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020653.1-2663s21c1
Sequence:CCGGGGTGCCAAACATCGTAATTAACTCGAGTTAATTACGATGTTTGGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020653.1-1868s21c1
Sequence:CCGGCATAGTTCATCACTGATTAATCTCGAGATTAATCAGTGATGAACTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020653.1-2819s21c1
Sequence:CCGGGGTATGGATATAACCTATTTACTCGAGTAAATAGGTTATATCCATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020653.1-1042s21c1
Sequence:GTACCGGACCAACTGTGATTCCCATATTCTCGAGAATATGGGAATCACAGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020653.1-1542s1c1
Sequence:CCGGCCCTCCTGAAACACCAAAGTACTCGAGTACTTTGGTGTTTCAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020653.1-2594s1c1
Sequence:CCGGGCATGTCGTATATGTGGTAAACTCGAGTTTACCACATATACGACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020653.1-482s1c1
Sequence:CCGGCCCTACAATGTTGAGAAGGAACTCGAGTTCCTTCTCAACATTGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020653.1-2363s1c1
Sequence:CCGGGCATATAGACAAGGCGCAAATCTCGAGATTTGCGCCTTGTCTATATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020653.1-1142s1c1
Sequence:CCGGCCAGTGGAGGATATGTCTAAACTCGAGTTTAGACATATCCTCCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks