EMAIL THIS PAGE TO A FRIEND

ZNF28

zinc finger protein 28

Synonyms: KOX24
Species: Human ZNF28(7576)
Gene ID:
43 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301742 ANTI-ZNF28 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006969 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006969 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006969 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006969 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074894 predicted 1238
2 SASI_Hs01_00074895 predicted 973
3 SASI_Hs01_00074897 predicted 1071
4 SASI_Hs01_00074898 predicted 2337
5 SASI_Hs01_00074899 predicted 1014
6 SASI_Hs01_00074901 predicted 971
7 SASI_Hs01_00074903 predicted 2332
8 SASI_Hs02_00342706 predicted 1180
9 SASI_Hs01_00074896 predicted 946
10 SASI_Hs01_00074900 predicted 2097
11 SASI_Hs01_00074902 predicted 944
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006969
ZNF28 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 28
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006969.2-1109s21c1
Sequence:CCGGGCGCTTCATACTGCAGACAAACTCGAGTTTGTCTGCAGTATGAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006969.2-2497s21c1
Sequence:CCGGCAACACCTTCCATCACAATTCCTCGAGGAATTGTGATGGAAGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006969.2-1071s21c1
Sequence:CCGGAGATCTTTGGTCACAATACATCTCGAGATGTATTGTGACCAAAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006969.2-1019s21c1
Sequence:CCGGCATCGTAGATCTCACATTGATCTCGAGATCAATGTGAGATCTACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006969.1-642s1c1
Sequence:CCGGCAAATGTGATGAGTGTGGCAACTCGAGTTGCCACACTCATCACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006969.1-700s1c1
Sequence:CCGGGCAATTCGTACTGGAGAGAAACTCGAGTTTCTCTCCAGTACGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006969.1-810s1c1
Sequence:CCGGCAAATGTGAAGACTGTGACAACTCGAGTTGTCACAGTCTTCACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006969.1-772s1c1
Sequence:CCGGGCAAGTCATCATAGTCTTCATCTCGAGATGAAGACTATGATGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006969.1-631s1c1
Sequence:CCGGGAGAAACCTTACAAATGTGATCTCGAGATCACATTTGTAAGGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006969.1-731s1c1
Sequence:CCGGGTAATGAATGTGGCATAGTTTCTCGAGAAACTATGCCACATTCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006969.1-826s1c1
Sequence:CCGGGACAAAGTTGTCAGTCACAAACTCGAGTTTGTGACTGACAACTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006969.1-839s1c1
Sequence:CCGGGTCACAAATCACAGCTTGAAACTCGAGTTTCAAGCTGTGATTTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006969
ZNF28 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 28
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006969.2-1109s21c1
Sequence:CCGGGCGCTTCATACTGCAGACAAACTCGAGTTTGTCTGCAGTATGAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006969.2-2497s21c1
Sequence:CCGGCAACACCTTCCATCACAATTCCTCGAGGAATTGTGATGGAAGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006969.2-1071s21c1
Sequence:CCGGAGATCTTTGGTCACAATACATCTCGAGATGTATTGTGACCAAAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006969.2-1019s21c1
Sequence:CCGGCATCGTAGATCTCACATTGATCTCGAGATCAATGTGAGATCTACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006969.1-642s1c1
Sequence:CCGGCAAATGTGATGAGTGTGGCAACTCGAGTTGCCACACTCATCACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006969.1-700s1c1
Sequence:CCGGGCAATTCGTACTGGAGAGAAACTCGAGTTTCTCTCCAGTACGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006969.1-810s1c1
Sequence:CCGGCAAATGTGAAGACTGTGACAACTCGAGTTGTCACAGTCTTCACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006969.1-772s1c1
Sequence:CCGGGCAAGTCATCATAGTCTTCATCTCGAGATGAAGACTATGATGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006969.1-631s1c1
Sequence:CCGGGAGAAACCTTACAAATGTGATCTCGAGATCACATTTGTAAGGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006969.1-731s1c1
Sequence:CCGGGTAATGAATGTGGCATAGTTTCTCGAGAAACTATGCCACATTCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006969.1-826s1c1
Sequence:CCGGGACAAAGTTGTCAGTCACAAACTCGAGTTTGTGACTGACAACTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006969.1-839s1c1
Sequence:CCGGGTCACAAATCACAGCTTGAAACTCGAGTTTCAAGCTGTGATTTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006969
ZNF28 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 28
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006969.2-1109s21c1
Sequence:CCGGGCGCTTCATACTGCAGACAAACTCGAGTTTGTCTGCAGTATGAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006969.2-2497s21c1
Sequence:CCGGCAACACCTTCCATCACAATTCCTCGAGGAATTGTGATGGAAGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006969.2-1071s21c1
Sequence:CCGGAGATCTTTGGTCACAATACATCTCGAGATGTATTGTGACCAAAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006969.2-1019s21c1
Sequence:CCGGCATCGTAGATCTCACATTGATCTCGAGATCAATGTGAGATCTACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006969.1-642s1c1
Sequence:CCGGCAAATGTGATGAGTGTGGCAACTCGAGTTGCCACACTCATCACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006969.1-700s1c1
Sequence:CCGGGCAATTCGTACTGGAGAGAAACTCGAGTTTCTCTCCAGTACGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006969.1-810s1c1
Sequence:CCGGCAAATGTGAAGACTGTGACAACTCGAGTTGTCACAGTCTTCACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006969.1-772s1c1
Sequence:CCGGGCAAGTCATCATAGTCTTCATCTCGAGATGAAGACTATGATGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006969.1-631s1c1
Sequence:CCGGGAGAAACCTTACAAATGTGATCTCGAGATCACATTTGTAAGGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006969.1-731s1c1
Sequence:CCGGGTAATGAATGTGGCATAGTTTCTCGAGAAACTATGCCACATTCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006969.1-826s1c1
Sequence:CCGGGACAAAGTTGTCAGTCACAAACTCGAGTTTGTGACTGACAACTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006969.1-839s1c1
Sequence:CCGGGTCACAAATCACAGCTTGAAACTCGAGTTTCAAGCTGTGATTTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks