EMAIL THIS PAGE TO A FRIEND

ZNF292

zinc finger protein 292

Synonyms: Nbla00365 ZFP292 ZN-16 Zn-15 bA393I2.3
UniProtKB ID: O60281, Q5W0B2, Q7Z3L7, Q9H8G3, Q9H8J4
Gene ID:
Domestic Rabbit(100359141) zinc finger protein 292
naked mole-rat(101704280) zinc finger protein 292
domestic guinea pig(100722561) zinc finger protein 292
cow(541264) zinc finger protein 292
sheep(101115376) zinc finger protein 292
chicken(421828) zinc finger protein 292
Horse(100070577) zinc finger protein 292
domestic cat(101088751) zinc finger protein 292
dog(481908) zinc finger protein 292
117 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015021 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015021 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015021 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU050661 MISSION® esiRNA esiRNA human ZNF292 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015021 Rosetta Predictions human pricing
XM_048070 Rosetta Predictions human pricing
XM_932361 Rosetta Predictions human pricing
XM_932366 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015021 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346806 predicted 2771
2 SASI_Hs02_00346807 predicted 6549
3 SASI_Hs02_00346808 predicted 1425
4 SASI_Hs02_00346809 predicted 3700
5 SASI_Hs02_00346810 predicted 4839
6 SASI_Hs02_00346811 predicted 555
7 SASI_Hs02_00346812 predicted 952
8 SASI_Hs02_00346813 predicted 4745
9 SASI_Hs02_00346814 predicted 991
10 SASI_Hs02_00346815 predicted 1095
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_048070 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261286 predicted 2751
2 SASI_Hs01_00261287 predicted 6520
3 SASI_Hs01_00261288 predicted 1407
4 SASI_Hs01_00261289 predicted 2209
5 SASI_Hs01_00261290 predicted 327
6 SASI_Hs01_00261291 predicted 3669
7 SASI_Hs01_00261292 predicted 4198
8 SASI_Hs01_00261293 predicted 4807
9 SASI_Hs01_00261294 predicted 4429
10 SASI_Hs01_00261295 predicted 4717
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248822 predicted 925
2 SASI_Hs01_00248823 predicted 737
3 SASI_Hs01_00248824 predicted 356
4 SASI_Hs01_00248825 predicted 929
5 SASI_Hs01_00248826 predicted 920
6 SASI_Hs01_00248827 predicted 345
7 SASI_Hs01_00248828 predicted 917
8 SASI_Hs01_00248829 predicted 1040
9 SASI_Hs01_00248830 predicted 943
10 SASI_Hs01_00248831 predicted 1034
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287831 predicted 267
2 SASI_Hs01_00287832 predicted 287
3 SASI_Hs01_00287833 predicted 262
4 SASI_Hs01_00287834 predicted 291
5 SASI_Hs01_00287835 predicted 225
6 SASI_Hs01_00287836 predicted 336
7 SASI_Hs01_00287837 predicted 235
8 SASI_Hs01_00287838 predicted 227
9 SASI_Hs01_00287839 predicted 295
10 SASI_Hs01_00287840 predicted 248
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015021
VALIDATED
ZNF292 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 292
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015021.1-5782s21c1
Sequence:CCGGTGACAAAGGATGCACTATTTACTCGAGTAAATAGTGCATCCTTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015021.1-9579s21c1
Sequence:CCGGCAGCGAGAGGTAGAGGTTATTCTCGAGAATAACCTCTACCTCTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015021.1-6853s21c1
Sequence:CCGGCGAATCTCCTCCGACACATTTCTCGAGAAATGTGTCGGAGGAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015021.1-3351s21c1
Sequence:GTACCGGGGATGTACTCGAACCTATAATCTCGAGATTATAGGTTCGAGTACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015021.1-6821s21c1
Sequence:CCGGTGAAGGCTGTGACCGTATATACTCGAGTATATACGGTCACAGCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015021
VALIDATED
ZNF292 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 292
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015021.1-5782s21c1
Sequence:CCGGTGACAAAGGATGCACTATTTACTCGAGTAAATAGTGCATCCTTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015021.1-9579s21c1
Sequence:CCGGCAGCGAGAGGTAGAGGTTATTCTCGAGAATAACCTCTACCTCTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015021.1-6853s21c1
Sequence:CCGGCGAATCTCCTCCGACACATTTCTCGAGAAATGTGTCGGAGGAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015021.1-3351s21c1
Sequence:GTACCGGGGATGTACTCGAACCTATAATCTCGAGATTATAGGTTCGAGTACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015021.1-6821s21c1
Sequence:CCGGTGAAGGCTGTGACCGTATATACTCGAGTATATACGGTCACAGCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015021
VALIDATED
ZNF292 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 292
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015021.1-5782s21c1
Sequence:CCGGTGACAAAGGATGCACTATTTACTCGAGTAAATAGTGCATCCTTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015021.1-9579s21c1
Sequence:CCGGCAGCGAGAGGTAGAGGTTATTCTCGAGAATAACCTCTACCTCTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015021.1-6853s21c1
Sequence:CCGGCGAATCTCCTCCGACACATTTCTCGAGAAATGTGTCGGAGGAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015021.1-3351s21c1
Sequence:GTACCGGGGATGTACTCGAACCTATAATCTCGAGATTATAGGTTCGAGTACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015021.1-6821s21c1
Sequence:CCGGTGAAGGCTGTGACCGTATATACTCGAGTATATACGGTCACAGCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks