EMAIL THIS PAGE TO A FRIEND

ZNF295-AS1

ZNF295 antisense RNA 1

Synonyms: C21orf121 NCRNA00318
Species: Human ZNF295-AS1(150142)
UniProtKB ID: Q8N0V1
Gene ID:
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198078 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198078 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198078 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198078 Rosetta Predictions human pricing
XR_040349 Rosetta Predictions human pricing
XR_040350 Rosetta Predictions human pricing
XR_040351 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095348 predicted 509
2 SASI_Hs01_00095349 predicted 511
3 SASI_Hs01_00095350 predicted 352
4 SASI_Hs01_00095351 predicted 557
5 SASI_Hs01_00095352 predicted 356
6 SASI_Hs01_00095353 predicted 349
7 SASI_Hs01_00095354 predicted 514
8 SASI_Hs01_00095355 predicted 506
9 SASI_Hs01_00095356 predicted 509
10 SASI_Hs01_00095357 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518062 predicted 339
2 SASI_Hs02_00518063 predicted 392
3 SASI_Hs02_00518064 predicted 348
4 SASI_Hs02_00518065 predicted 348
5 SASI_Hs02_00518066 predicted 331
6 SASI_Hs02_00518067 predicted 335
7 SASI_Hs02_00518068 predicted 329
8 SASI_Hs02_00518069 predicted 397
9 SASI_Hs02_00518070 predicted 211
10 SASI_Hs02_00518071 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040350 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518072 predicted 334
2 SASI_Hs02_00518073 predicted 392
3 SASI_Hs02_00518074 predicted 348
4 SASI_Hs02_00518075 predicted 342
5 SASI_Hs02_00518076 predicted 336
6 SASI_Hs02_00518077 predicted 335
7 SASI_Hs02_00518078 predicted 333
8 SASI_Hs02_00518079 predicted 395
9 SASI_Hs02_00518080 predicted 207
10 SASI_Hs02_00518081 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518082 predicted 334
2 SASI_Hs02_00518083 predicted 390
3 SASI_Hs02_00518084 predicted 346
4 SASI_Hs02_00518085 predicted 347
5 SASI_Hs02_00518086 predicted 337
6 SASI_Hs02_00518087 predicted 332
7 SASI_Hs02_00518088 predicted 328
8 SASI_Hs02_00518089 predicted 390
9 SASI_Hs02_00518090 predicted 212
10 SASI_Hs02_00518091 predicted 333
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198078
ZNF295-AS1 MISSION shRNA Bacterial Glycerol Stock
ZNF295 antisense RNA 1
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000168385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198078.1-505s1c1
Sequence:CCGGGAGGTGATACTGACTTGAGATCTCGAGATCTCAAGTCAGTATCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198078.1-510s1c1
Sequence:CCGGGATACTGACTTGAGATCTTATCTCGAGATAAGATCTCAAGTCAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198078
ZNF295-AS1 MISSION shRNA shRNA Plasmid DNA
ZNF295 antisense RNA 1
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000168385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198078.1-505s1c1
Sequence:CCGGGAGGTGATACTGACTTGAGATCTCGAGATCTCAAGTCAGTATCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198078.1-510s1c1
Sequence:CCGGGATACTGACTTGAGATCTTATCTCGAGATAAGATCTCAAGTCAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198078
ZNF295-AS1 MISSION shRNA Lentiviral Transduction Particles
ZNF295 antisense RNA 1
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000168385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198078.1-505s1c1
Sequence:CCGGGAGGTGATACTGACTTGAGATCTCGAGATCTCAAGTCAGTATCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198078.1-510s1c1
Sequence:CCGGGATACTGACTTGAGATCTTATCTCGAGATAAGATCTCAAGTCAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks