EMAIL THIS PAGE TO A FRIEND

ZNF296

zinc finger protein 296

Synonyms: ZFP296 ZNF342
UniProtKB ID: Q8WUU4
Gene ID:
Zebrafish(553232) zinc finger protein 296
dog(484453) zinc finger protein 296
domestic cat(101085255) zinc finger protein 296
Horse(100065573) zinc finger protein 296
naked mole-rat(101721147) zinc finger protein 296
domestic guinea pig(100719668) zinc finger protein 296
cow(539503) zinc finger protein 296
sheep(101113522) zinc finger protein 296
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145288 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145288 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145288 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145288 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145288 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216543 predicted 430
2 SASI_Hs01_00216544 predicted 820
3 SASI_Hs01_00216545 predicted 1221
4 SASI_Hs01_00216546 predicted 562
5 SASI_Hs01_00216548 predicted 361
6 SASI_Hs01_00216550 predicted 1111
7 SASI_Hs01_00216551 predicted 1115
8 SASI_Hs01_00216552 predicted 1325
9 SASI_Hs02_00365171 predicted 596
10 SASI_Hs02_00365172 predicted 430
11 SASI_Hs01_00216547 predicted 1304
12 SASI_Hs01_00216549 predicted 428
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145288
ZNF296 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 296
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145288.1-601s1c1
Sequence:CCGGCTGTCCATCTACCAGACAGAACTCGAGTTCTGTCTGGTAGATGGACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145288.1-534s1c1
Sequence:CCGGCCTGCGCTGTGGCAAACAGTTCTCGAGAACTGTTTGCCACAGCGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145288.1-117s1c1
Sequence:CCGGCCCAGACGACGAGATGGAAATCTCGAGATTTCCATCTCGTCGTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145288.1-1131s1c1
Sequence:CCGGACAAAGAACTGACCCTGCAAACTCGAGTTTGCAGGGTCAGTTCTTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145288.1-1299s1c1
Sequence:CCGGCACCTGTGAGTTCTGCAACTACTCGAGTAGTTGCAGAACTCACAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145288.1-780s21c1
Sequence:CCGGCTCCTTCAGCAACCTCAAAGTCTCGAGACTTTGAGGTTGCTGAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145288.1-1221s21c1
Sequence:CCGGTGAGTTCTGCGGGAAGCATTTCTCGAGAAATGCTTCCCGCAGAACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145288.1-371s21c1
Sequence:CCGGCCGACAAACACCCAGATCTGTCTCGAGACAGATCTGGGTGTTTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145288
ZNF296 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 296
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145288.1-601s1c1
Sequence:CCGGCTGTCCATCTACCAGACAGAACTCGAGTTCTGTCTGGTAGATGGACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145288.1-534s1c1
Sequence:CCGGCCTGCGCTGTGGCAAACAGTTCTCGAGAACTGTTTGCCACAGCGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145288.1-117s1c1
Sequence:CCGGCCCAGACGACGAGATGGAAATCTCGAGATTTCCATCTCGTCGTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145288.1-1131s1c1
Sequence:CCGGACAAAGAACTGACCCTGCAAACTCGAGTTTGCAGGGTCAGTTCTTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145288.1-1299s1c1
Sequence:CCGGCACCTGTGAGTTCTGCAACTACTCGAGTAGTTGCAGAACTCACAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145288.1-780s21c1
Sequence:CCGGCTCCTTCAGCAACCTCAAAGTCTCGAGACTTTGAGGTTGCTGAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145288.1-1221s21c1
Sequence:CCGGTGAGTTCTGCGGGAAGCATTTCTCGAGAAATGCTTCCCGCAGAACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145288.1-371s21c1
Sequence:CCGGCCGACAAACACCCAGATCTGTCTCGAGACAGATCTGGGTGTTTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145288
ZNF296 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 296
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145288.1-601s1c1
Sequence:CCGGCTGTCCATCTACCAGACAGAACTCGAGTTCTGTCTGGTAGATGGACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145288.1-534s1c1
Sequence:CCGGCCTGCGCTGTGGCAAACAGTTCTCGAGAACTGTTTGCCACAGCGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145288.1-117s1c1
Sequence:CCGGCCCAGACGACGAGATGGAAATCTCGAGATTTCCATCTCGTCGTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145288.1-1131s1c1
Sequence:CCGGACAAAGAACTGACCCTGCAAACTCGAGTTTGCAGGGTCAGTTCTTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145288.1-1299s1c1
Sequence:CCGGCACCTGTGAGTTCTGCAACTACTCGAGTAGTTGCAGAACTCACAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145288.1-780s21c1
Sequence:CCGGCTCCTTCAGCAACCTCAAAGTCTCGAGACTTTGAGGTTGCTGAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145288.1-1221s21c1
Sequence:CCGGTGAGTTCTGCGGGAAGCATTTCTCGAGAAATGCTTCCCGCAGAACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145288.1-371s21c1
Sequence:CCGGCCGACAAACACCCAGATCTGTCTCGAGACAGATCTGGGTGTTTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks