EMAIL THIS PAGE TO A FRIEND

ZNF2

zinc finger protein 2

Synonyms: A1-5 ZNF661 Zfp661
Species: Human ZNF2(7549), domestic guinea pig Znf2(100717658), naked mole-rat Znf2(101699178), cow ZNF2(539022), sheep ZNF2(101115016)
UniProtKB ID: Q9BSG1, A8MWV7, Q4ZFY6, Q96G44, Q9UMC5
Gene ID:
domestic guinea pig(100717658) zinc finger protein 2
naked mole-rat(101699178) zinc finger protein 2
cow(539022) zinc finger protein 2
sheep(101115016) zinc finger protein 2
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021088 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021088 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021088 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU062851 MISSION® esiRNA esiRNA human ZNF2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017396 Rosetta Predictions human pricing
NM_021088 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017396 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197837 predicted 880
2 SASI_Hs01_00197838 predicted 1695
3 SASI_Hs01_00197839 predicted 1706
4 SASI_Hs02_00306725 predicted 1685
5 SASI_Hs01_00197842 predicted 1096
6 SASI_Hs01_00197843 predicted 1628
7 SASI_Hs01_00197844 predicted 1653
8 SASI_Hs01_00197845 predicted 1116
9 SASI_Hs01_00197846 predicted 711
10 SASI_Hs02_00306726 predicted 656
11 SASI_Hs01_00197840 predicted 1690
12 SASI_Hs01_00197841 predicted 1723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021088 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023091 predicted 951
2 SASI_Hs01_00023092 predicted 1765
3 SASI_Hs01_00023093 predicted 1785
4 SASI_Hs02_00354573 predicted 1760
5 SASI_Hs01_00023096 predicted 1174
6 SASI_Hs01_00023097 predicted 1702
7 SASI_Hs01_00023098 predicted 1723
8 SASI_Hs01_00023099 predicted 1184
9 SASI_Hs01_00023100 predicted 779
10 SASI_Hs02_00354574 predicted 729
11 SASI_Hs01_00023094 predicted 1763
12 SASI_Hs01_00023095 predicted 1798
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021088
ZNF2 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021088.2-817s21c1
Sequence:CCGGAGTCCTCTGTGTCCTAAATTTCTCGAGAAATTTAGGACACAGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021088.2-2077s21c1
Sequence:CCGGTGATATCACAGCAGTACTATTCTCGAGAATAGTACTGCTGTGATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021088.2-940s21c1
Sequence:CCGGTCAGCCCTGTCCAGGGAAATTCTCGAGAATTTCCCTGGACAGGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021088.2-1360s21c1
Sequence:CCGGCTTACTCGCCATCAGCTAATCCTCGAGGATTAGCTGATGGCGAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021088.2-1474s21c1
Sequence:CCGGGACCCTCGCTATCAGTGTAACCTCGAGGTTACACTGATAGCGAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021088.1-1791s1c1
Sequence:CCGGCCTGTCTTAAAGCTGCCATTTCTCGAGAAATGGCAGCTTTAAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021088.1-1432s1c1
Sequence:CCGGCGTCTCTGAATAGACATCAGACTCGAGTCTGATGTCTATTCAGAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021088.1-1303s1c1
Sequence:CCGGGTCCTTATGAATGTCATCAGTCTCGAGACTGATGACATTCATAAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021088.1-1199s1c1
Sequence:CCGGGCGAATTCACACTGGAGAGAACTCGAGTTCTCTCCAGTGTGAATTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021088
ZNF2 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021088.2-817s21c1
Sequence:CCGGAGTCCTCTGTGTCCTAAATTTCTCGAGAAATTTAGGACACAGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021088.2-2077s21c1
Sequence:CCGGTGATATCACAGCAGTACTATTCTCGAGAATAGTACTGCTGTGATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021088.2-940s21c1
Sequence:CCGGTCAGCCCTGTCCAGGGAAATTCTCGAGAATTTCCCTGGACAGGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021088.2-1360s21c1
Sequence:CCGGCTTACTCGCCATCAGCTAATCCTCGAGGATTAGCTGATGGCGAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021088.2-1474s21c1
Sequence:CCGGGACCCTCGCTATCAGTGTAACCTCGAGGTTACACTGATAGCGAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021088.1-1791s1c1
Sequence:CCGGCCTGTCTTAAAGCTGCCATTTCTCGAGAAATGGCAGCTTTAAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021088.1-1432s1c1
Sequence:CCGGCGTCTCTGAATAGACATCAGACTCGAGTCTGATGTCTATTCAGAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021088.1-1303s1c1
Sequence:CCGGGTCCTTATGAATGTCATCAGTCTCGAGACTGATGACATTCATAAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021088.1-1199s1c1
Sequence:CCGGGCGAATTCACACTGGAGAGAACTCGAGTTCTCTCCAGTGTGAATTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021088
ZNF2 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021088.2-817s21c1
Sequence:CCGGAGTCCTCTGTGTCCTAAATTTCTCGAGAAATTTAGGACACAGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021088.2-2077s21c1
Sequence:CCGGTGATATCACAGCAGTACTATTCTCGAGAATAGTACTGCTGTGATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021088.2-940s21c1
Sequence:CCGGTCAGCCCTGTCCAGGGAAATTCTCGAGAATTTCCCTGGACAGGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021088.2-1360s21c1
Sequence:CCGGCTTACTCGCCATCAGCTAATCCTCGAGGATTAGCTGATGGCGAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021088.2-1474s21c1
Sequence:CCGGGACCCTCGCTATCAGTGTAACCTCGAGGTTACACTGATAGCGAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021088.1-1791s1c1
Sequence:CCGGCCTGTCTTAAAGCTGCCATTTCTCGAGAAATGGCAGCTTTAAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021088.1-1432s1c1
Sequence:CCGGCGTCTCTGAATAGACATCAGACTCGAGTCTGATGTCTATTCAGAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021088.1-1303s1c1
Sequence:CCGGGTCCTTATGAATGTCATCAGTCTCGAGACTGATGACATTCATAAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021088.1-1199s1c1
Sequence:CCGGGCGAATTCACACTGGAGAGAACTCGAGTTCTCTCCAGTGTGAATTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks