EMAIL THIS PAGE TO A FRIEND

ZNF302

zinc finger protein 302

Synonyms: HSD16 MST154 MSTP154 ZNF135L ZNF140L ZNF327
UniProtKB ID: Q9NR11, Q658J3, Q9BZD8, Q9P0J4
Gene ID:
chicken(417303) zinc finger protein 302
cow(338407) zinc finger protein 302
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301808 Anti-ZNF302 affinity isolated antibody human
immunohistochemistry pricing
SAB1400634 Anti-ZNF302 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB2102854 Anti-ZNF302 antibody produced in rabbit affinity isolated antibody canine, bovine, zebrafish, rabbit, rat, guinea pig, human, horse, mouse
western blot pricing
SAB2104362 Anti-ZNF302 antibody produced in rabbit affinity isolated antibody horse, human, guinea pig, mouse, bovine, rabbit, canine, rat
western blot pricing
HPA059503 Anti-ZNF302 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB2104667 Anti-ZNF302, (N-terminal) antibody produced in rabbit affinity isolated antibody horse, rabbit, canine, human, rat, bovine, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018443 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018443 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018443 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU115041 MISSION® esiRNA esiRNA human ZNF302 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012320 Rosetta Predictions human pricing
NM_018443 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012320 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100611 predicted 652
2 SASI_Hs01_00100617 predicted 1348
3 SASI_Hs02_00306077 predicted 1125
4 SASI_Hs02_00306078 predicted 579
5 SASI_Hs02_00306079 predicted 601
6 SASI_Hs01_00100612 predicted 613
7 SASI_Hs01_00100613 predicted 794
8 SASI_Hs01_00100614 predicted 404
9 SASI_Hs01_00100615 predicted 383
10 SASI_Hs01_00100616 predicted 1374
11 SASI_Hs01_00100618 predicted 1486
12 SASI_Hs01_00100619 predicted 622
13 SASI_Hs01_00100620 predicted 487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221682 predicted 679
2 SASI_Hs01_00221688 predicted 1370
3 SASI_Hs02_00351974 predicted 1148
4 SASI_Hs02_00351975 predicted 607
5 SASI_Hs02_00351976 predicted 623
6 SASI_Hs01_00221683 predicted 632
7 SASI_Hs01_00221684 predicted 821
8 SASI_Hs01_00221685 predicted 421
9 SASI_Hs01_00221686 predicted 408
10 SASI_Hs01_00221687 predicted 1394
11 SASI_Hs01_00221689 predicted 1502
12 SASI_Hs01_00221690 predicted 640
13 SASI_Hs01_00221691 predicted 506
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018443
ZNF302 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 302
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018443.1-1131s1c1
Sequence:CCGGCCCTTCTCATTCAGCATCTAACTCGAGTTAGATGCTGAATGAGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018443.1-519s1c1
Sequence:CCGGCCCAACCAGTAACAATGGAAACTCGAGTTTCCATTGTTACTGGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018443.1-601s1c1
Sequence:CCGGCGACACATTTAGAAGCACCTTCTCGAGAAGGTGCTTCTAAATGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018443.1-966s1c1
Sequence:CCGGCCCTTACACGACATCAGATAACTCGAGTTATCTGATGTCGTGTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018443.1-1077s1c1
Sequence:CCGGCGGGAGAGAAACCGTATGAATCTCGAGATTCATACGGTTTCTCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018443.2-311s21c1
Sequence:CCGGAGAGTGGGCATGCCTAGATTCCTCGAGGAATCTAGGCATGCCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018443.2-615s21c1
Sequence:CCGGTATACAGAATGCGACACATTTCTCGAGAAATGTGTCGCATTCTGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018443.2-389s21c1
Sequence:GTACCGGTGTAGGTCTTTCCGTAACTAACTCGAGTTAGTTACGGAAAGACCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018443.2-1887s21c1
Sequence:CCGGATTCATAGATCCTCCCTTATTCTCGAGAATAAGGGAGGATCTATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018443.2-1147s21c1
Sequence:CCGGGTCGTGTGTCCCTTCTCATTCCTCGAGGAATGAGAAGGGACACACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018443
ZNF302 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 302
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018443.1-1131s1c1
Sequence:CCGGCCCTTCTCATTCAGCATCTAACTCGAGTTAGATGCTGAATGAGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018443.1-519s1c1
Sequence:CCGGCCCAACCAGTAACAATGGAAACTCGAGTTTCCATTGTTACTGGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018443.1-601s1c1
Sequence:CCGGCGACACATTTAGAAGCACCTTCTCGAGAAGGTGCTTCTAAATGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018443.1-966s1c1
Sequence:CCGGCCCTTACACGACATCAGATAACTCGAGTTATCTGATGTCGTGTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018443.1-1077s1c1
Sequence:CCGGCGGGAGAGAAACCGTATGAATCTCGAGATTCATACGGTTTCTCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018443.2-311s21c1
Sequence:CCGGAGAGTGGGCATGCCTAGATTCCTCGAGGAATCTAGGCATGCCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018443.2-615s21c1
Sequence:CCGGTATACAGAATGCGACACATTTCTCGAGAAATGTGTCGCATTCTGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018443.2-389s21c1
Sequence:GTACCGGTGTAGGTCTTTCCGTAACTAACTCGAGTTAGTTACGGAAAGACCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018443.2-1887s21c1
Sequence:CCGGATTCATAGATCCTCCCTTATTCTCGAGAATAAGGGAGGATCTATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018443.2-1147s21c1
Sequence:CCGGGTCGTGTGTCCCTTCTCATTCCTCGAGGAATGAGAAGGGACACACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018443
ZNF302 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 302
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018443.1-1131s1c1
Sequence:CCGGCCCTTCTCATTCAGCATCTAACTCGAGTTAGATGCTGAATGAGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018443.1-519s1c1
Sequence:CCGGCCCAACCAGTAACAATGGAAACTCGAGTTTCCATTGTTACTGGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018443.1-601s1c1
Sequence:CCGGCGACACATTTAGAAGCACCTTCTCGAGAAGGTGCTTCTAAATGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018443.1-966s1c1
Sequence:CCGGCCCTTACACGACATCAGATAACTCGAGTTATCTGATGTCGTGTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018443.1-1077s1c1
Sequence:CCGGCGGGAGAGAAACCGTATGAATCTCGAGATTCATACGGTTTCTCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018443.2-311s21c1
Sequence:CCGGAGAGTGGGCATGCCTAGATTCCTCGAGGAATCTAGGCATGCCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018443.2-615s21c1
Sequence:CCGGTATACAGAATGCGACACATTTCTCGAGAAATGTGTCGCATTCTGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018443.2-389s21c1
Sequence:GTACCGGTGTAGGTCTTTCCGTAACTAACTCGAGTTAGTTACGGAAAGACCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018443.2-1887s21c1
Sequence:CCGGATTCATAGATCCTCCCTTATTCTCGAGAATAAGGGAGGATCTATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018443.2-1147s21c1
Sequence:CCGGGTCGTGTGTCCCTTCTCATTCCTCGAGGAATGAGAAGGGACACACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks