EMAIL THIS PAGE TO A FRIEND

ZNF304

zinc finger protein 304

UniProtKB ID: Q9HCX3
Gene ID:
cow(526123) zinc finger protein 304
naked mole-rat(101708995) zinc finger protein 304
domestic cat(101099603) zinc finger protein 304
37 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020657 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020657 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020657 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153531 MISSION® esiRNA esiRNA human ZNF304 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020657 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189770 predicted 609
2 SASI_Hs01_00189771 predicted 1500
3 SASI_Hs01_00189772 predicted 696
4 SASI_Hs01_00189773 predicted 924
5 SASI_Hs01_00189774 predicted 749
6 SASI_Hs01_00189777 predicted 1396
7 SASI_Hs02_00353639 predicted 1198
8 SASI_Hs02_00353640 predicted 640
9 SASI_Hs02_00353641 predicted 874
10 SASI_Hs02_00353642 predicted 554
11 SASI_Hs01_00189768 predicted 1054
12 SASI_Hs01_00189769 predicted 694
13 SASI_Hs01_00189775 predicted 1571
14 SASI_Hs01_00189776 predicted 1067
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020657
VALIDATED
ZNF304 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 304
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020657.2-870s21c1
Sequence:CCGGACATGTTAGGGAGATCCTTTACTCGAGTAAAGGATCTCCCTAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020657.2-1168s21c1
Sequence:CCGGCAAGGAGAAATCAGCTCTTATCTCGAGATAAGAGCTGATTTCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020657.2-2340s21c1
Sequence:CCGGCTTTAGCTGCATCTCTTAAACCTCGAGGTTTAAGAGATGCAGCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020657.2-3167s21c1
Sequence:CCGGAGTCTAGTTTGACCTAATTTACTCGAGTAAATTAGGTCAAACTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020657.2-1722s21c1
Sequence:CCGGGATCCTACGTGTGCAGCAAATCTCGAGATTTGCTGCACACGTAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020657.1-2886s1c1
Sequence:CCGGGCTCTGATTTATACAGTGATACTCGAGTATCACTGTATAAATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020657.1-1068s1c1
Sequence:CCGGAGGAGAAATCAGCTCTTATTACTCGAGTAATAAGAGCTGATTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020657.1-2244s1c1
Sequence:CCGGCTGCATCTCTTAAACTTGTTTCTCGAGAAACAAGTTTAAGAGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_020657.1-1065s1c1
Sequence:CCGGTCAAGGAGAAATCAGCTCTTACTCGAGTAAGAGCTGATTTCTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020657.1-766s1c1
Sequence:CCGGCCACATGTTAGGGAGATCCTTCTCGAGAAGGATCTCCCTAACATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020657
VALIDATED
ZNF304 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 304
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020657.2-870s21c1
Sequence:CCGGACATGTTAGGGAGATCCTTTACTCGAGTAAAGGATCTCCCTAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020657.2-1168s21c1
Sequence:CCGGCAAGGAGAAATCAGCTCTTATCTCGAGATAAGAGCTGATTTCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020657.2-2340s21c1
Sequence:CCGGCTTTAGCTGCATCTCTTAAACCTCGAGGTTTAAGAGATGCAGCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020657.2-3167s21c1
Sequence:CCGGAGTCTAGTTTGACCTAATTTACTCGAGTAAATTAGGTCAAACTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020657.2-1722s21c1
Sequence:CCGGGATCCTACGTGTGCAGCAAATCTCGAGATTTGCTGCACACGTAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020657.1-2886s1c1
Sequence:CCGGGCTCTGATTTATACAGTGATACTCGAGTATCACTGTATAAATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020657.1-1068s1c1
Sequence:CCGGAGGAGAAATCAGCTCTTATTACTCGAGTAATAAGAGCTGATTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020657.1-2244s1c1
Sequence:CCGGCTGCATCTCTTAAACTTGTTTCTCGAGAAACAAGTTTAAGAGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_020657.1-1065s1c1
Sequence:CCGGTCAAGGAGAAATCAGCTCTTACTCGAGTAAGAGCTGATTTCTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020657.1-766s1c1
Sequence:CCGGCCACATGTTAGGGAGATCCTTCTCGAGAAGGATCTCCCTAACATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020657
VALIDATED
ZNF304 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 304
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020657.2-870s21c1
Sequence:CCGGACATGTTAGGGAGATCCTTTACTCGAGTAAAGGATCTCCCTAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020657.2-1168s21c1
Sequence:CCGGCAAGGAGAAATCAGCTCTTATCTCGAGATAAGAGCTGATTTCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020657.2-2340s21c1
Sequence:CCGGCTTTAGCTGCATCTCTTAAACCTCGAGGTTTAAGAGATGCAGCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020657.2-3167s21c1
Sequence:CCGGAGTCTAGTTTGACCTAATTTACTCGAGTAAATTAGGTCAAACTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020657.2-1722s21c1
Sequence:CCGGGATCCTACGTGTGCAGCAAATCTCGAGATTTGCTGCACACGTAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020657.1-2886s1c1
Sequence:CCGGGCTCTGATTTATACAGTGATACTCGAGTATCACTGTATAAATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020657.1-1068s1c1
Sequence:CCGGAGGAGAAATCAGCTCTTATTACTCGAGTAATAAGAGCTGATTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020657.1-2244s1c1
Sequence:CCGGCTGCATCTCTTAAACTTGTTTCTCGAGAAACAAGTTTAAGAGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_020657.1-1065s1c1
Sequence:CCGGTCAAGGAGAAATCAGCTCTTACTCGAGTAAGAGCTGATTTCTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020657.1-766s1c1
Sequence:CCGGCCACATGTTAGGGAGATCCTTCTCGAGAAGGATCTCCCTAACATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks