EMAIL THIS PAGE TO A FRIEND

ZNF30

zinc finger protein 30

Synonyms: KOX28
UniProtKB ID: P17039, A5PLP1, A8K320, B4DIC0, Q6N068
Gene ID:
dog(484365) zinc finger protein 420-like
Horse(100058768) zinc finger protein 30
domestic cat(101081101) zinc finger protein 30
41 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102852 Anti-ZNF30 antibody produced in rabbit affinity isolated antibody zebrafish, rat, bovine, mouse, horse, human, guinea pig, rabbit
western blot pricing
HPA030400 Anti-ZNF30 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB1307149 ANTI-ZNF30(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194325 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194325 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194325 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099437 Rosetta Predictions human pricing
NM_001099438 Rosetta Predictions human pricing
NM_194325 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320739 predicted 1216
2 SASI_Hs02_00320740 predicted 1477
3 SASI_Hs02_00320741 predicted 995
4 SASI_Hs02_00320742 predicted 876
5 SASI_Hs02_00320743 predicted 751
6 SASI_Hs02_00320744 predicted 2022
7 SASI_Hs02_00320745 predicted 1034
8 SASI_Hs02_00320746 predicted 1454
9 SASI_Hs02_00320747 predicted 1025
10 SASI_Hs02_00320748 predicted 2242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320749 predicted 1280
2 SASI_Hs02_00320750 predicted 1547
3 SASI_Hs02_00320751 predicted 1058
4 SASI_Hs02_00320752 predicted 947
5 SASI_Hs02_00320753 predicted 821
6 SASI_Hs02_00320754 predicted 2088
7 SASI_Hs02_00320755 predicted 1098
8 SASI_Hs02_00320756 predicted 1518
9 SASI_Hs02_00320757 predicted 1092
10 SASI_Hs02_00320758 predicted 2314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371474 predicted 1212
2 SASI_Hs01_00241127 predicted 1472
3 SASI_Hs01_00241132 predicted 996
4 SASI_Hs02_00371475 predicted 876
5 SASI_Hs01_00241128 predicted 754
6 SASI_Hs01_00241129 predicted 2026
7 SASI_Hs01_00241130 predicted 1023
8 SASI_Hs02_00371476 predicted 1443
9 SASI_Hs01_00241131 predicted 1021
10 SASI_Hs01_00241134 predicted 2240
11 SASI_Hs01_00241126 predicted 1011
12 SASI_Hs01_00241133 predicted 678
13 SASI_Hs01_00241135 predicted 855
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194325
VALIDATED
ZNF30 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 30
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_194325.1-2023s1c1
Sequence:CCGGGCCTTTACTGTTTATGGACAACTCGAGTTGTCCATAAACAGTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194325.1-1028s1c1
Sequence:CCGGGCTATCAACTTACAGTACATACTCGAGTATGTACTGTAAGTTGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_194325.1-772s1c1
Sequence:CCGGCAAGACTCAAAGCCTGTTCAACTCGAGTTGAACAGGCTTTGAGTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194325.1-1867s1c1
Sequence:CCGGGCCTCGTACCTTGTACAACATCTCGAGATGTTGTACAAGGTACGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194325.1-652s1c1
Sequence:CCGGGATGATACAATCGGCTGTAAACTCGAGTTTACAGCCGATTGTATCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194325.2-535s21c1
Sequence:CCGGATGGGACATTCCCGTTCTAAACTCGAGTTTAGAACGGGAATGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194325.2-1866s21c1
Sequence:CCGGCTCGTACCTTGTACAACATAGCTCGAGCTATGTTGTACAAGGTACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194325.2-564s21c1
Sequence:CCGGGATCGCCTTATTGGAACAATGCTCGAGCATTGTTCCAATAAGGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194325.2-2354s21c1
Sequence:CCGGGGTCTATTCTCATCTTATAATCTCGAGATTATAAGATGAGAATAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_194325.2-640s21c1
Sequence:GTACCGGCAGTTGGAAGATGATACAATCCTCGAGGATTGTATCATCTTCCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194325
VALIDATED
ZNF30 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 30
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_194325.1-2023s1c1
Sequence:CCGGGCCTTTACTGTTTATGGACAACTCGAGTTGTCCATAAACAGTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194325.1-1028s1c1
Sequence:CCGGGCTATCAACTTACAGTACATACTCGAGTATGTACTGTAAGTTGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_194325.1-772s1c1
Sequence:CCGGCAAGACTCAAAGCCTGTTCAACTCGAGTTGAACAGGCTTTGAGTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194325.1-1867s1c1
Sequence:CCGGGCCTCGTACCTTGTACAACATCTCGAGATGTTGTACAAGGTACGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194325.1-652s1c1
Sequence:CCGGGATGATACAATCGGCTGTAAACTCGAGTTTACAGCCGATTGTATCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194325.2-535s21c1
Sequence:CCGGATGGGACATTCCCGTTCTAAACTCGAGTTTAGAACGGGAATGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194325.2-1866s21c1
Sequence:CCGGCTCGTACCTTGTACAACATAGCTCGAGCTATGTTGTACAAGGTACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194325.2-564s21c1
Sequence:CCGGGATCGCCTTATTGGAACAATGCTCGAGCATTGTTCCAATAAGGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194325.2-2354s21c1
Sequence:CCGGGGTCTATTCTCATCTTATAATCTCGAGATTATAAGATGAGAATAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_194325.2-640s21c1
Sequence:GTACCGGCAGTTGGAAGATGATACAATCCTCGAGGATTGTATCATCTTCCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194325
VALIDATED
ZNF30 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 30
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_194325.1-2023s1c1
Sequence:CCGGGCCTTTACTGTTTATGGACAACTCGAGTTGTCCATAAACAGTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194325.1-1028s1c1
Sequence:CCGGGCTATCAACTTACAGTACATACTCGAGTATGTACTGTAAGTTGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_194325.1-772s1c1
Sequence:CCGGCAAGACTCAAAGCCTGTTCAACTCGAGTTGAACAGGCTTTGAGTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194325.1-1867s1c1
Sequence:CCGGGCCTCGTACCTTGTACAACATCTCGAGATGTTGTACAAGGTACGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194325.1-652s1c1
Sequence:CCGGGATGATACAATCGGCTGTAAACTCGAGTTTACAGCCGATTGTATCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194325.2-535s21c1
Sequence:CCGGATGGGACATTCCCGTTCTAAACTCGAGTTTAGAACGGGAATGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194325.2-1866s21c1
Sequence:CCGGCTCGTACCTTGTACAACATAGCTCGAGCTATGTTGTACAAGGTACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194325.2-564s21c1
Sequence:CCGGGATCGCCTTATTGGAACAATGCTCGAGCATTGTTCCAATAAGGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194325.2-2354s21c1
Sequence:CCGGGGTCTATTCTCATCTTATAATCTCGAGATTATAAGATGAGAATAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_194325.2-640s21c1
Sequence:GTACCGGCAGTTGGAAGATGATACAATCCTCGAGGATTGTATCATCTTCCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks