EMAIL THIS PAGE TO A FRIEND

ZNF311

zinc finger protein 311

Synonyms: zf31
UniProtKB ID: Q5JNZ3, A2BFK5, B0S7Y4, Q92971
Gene ID:
dog(488334) zinc finger protein 311
Horse(100060003) zinc finger protein 311
domestic cat(101089356) zinc finger protein 311
cow(507236) zinc finger protein 311
sheep(101123079) zinc finger protein 311
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010877 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010877 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010877 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU104661 MISSION® esiRNA esiRNA human AL662865.4-201 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010877 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052158 predicted 1126
2 SASI_Hs01_00052159 predicted 847
3 SASI_Hs01_00052160 predicted 1249
4 SASI_Hs01_00052161 predicted 1292
5 SASI_Hs01_00052162 predicted 1548
6 SASI_Hs01_00052163 predicted 933
7 SASI_Hs01_00052164 predicted 1211
8 SASI_Hs01_00052165 predicted 650
9 SASI_Hs01_00052166 predicted 960
10 SASI_Hs02_00305833 predicted 1699
11 SASI_Hs01_00052167 predicted 617
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010877
ZNF311 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 311
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108145    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010877.1-2856s1c1
Sequence:CCGGGCTGGTCCTTCTGTCTCTTATCTCGAGATAAGAGACAGAAGGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010877.1-1126s1c1
Sequence:CCGGCCATTTCCTAAACCTCCTTTACTCGAGTAAAGGAGGTTTAGGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010877.1-1261s1c1
Sequence:CCGGGCAAGTTCACAACAAGAGATTCTCGAGAATCTCTTGTTGTGAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010877.1-1293s1c1
Sequence:CCGGAGAAGCCTACTGGATGAAATTCTCGAGAATTTCATCCAGTAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010877.1-2594s1c1
Sequence:CCGGGCTCAGCTCTGATTGGACATACTCGAGTATGTCCAATCAGAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010877
ZNF311 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 311
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108145    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010877.1-2856s1c1
Sequence:CCGGGCTGGTCCTTCTGTCTCTTATCTCGAGATAAGAGACAGAAGGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010877.1-1126s1c1
Sequence:CCGGCCATTTCCTAAACCTCCTTTACTCGAGTAAAGGAGGTTTAGGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010877.1-1261s1c1
Sequence:CCGGGCAAGTTCACAACAAGAGATTCTCGAGAATCTCTTGTTGTGAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010877.1-1293s1c1
Sequence:CCGGAGAAGCCTACTGGATGAAATTCTCGAGAATTTCATCCAGTAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010877.1-2594s1c1
Sequence:CCGGGCTCAGCTCTGATTGGACATACTCGAGTATGTCCAATCAGAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010877
ZNF311 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 311
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108145    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010877.1-2856s1c1
Sequence:CCGGGCTGGTCCTTCTGTCTCTTATCTCGAGATAAGAGACAGAAGGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010877.1-1126s1c1
Sequence:CCGGCCATTTCCTAAACCTCCTTTACTCGAGTAAAGGAGGTTTAGGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010877.1-1261s1c1
Sequence:CCGGGCAAGTTCACAACAAGAGATTCTCGAGAATCTCTTGTTGTGAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010877.1-1293s1c1
Sequence:CCGGAGAAGCCTACTGGATGAAATTCTCGAGAATTTCATCCAGTAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010877.1-2594s1c1
Sequence:CCGGGCTCAGCTCTGATTGGACATACTCGAGTATGTCCAATCAGAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks