EMAIL THIS PAGE TO A FRIEND

ZNF317

zinc finger protein 317

UniProtKB ID: Q96PQ6, Q6DCA9, Q96PM0, Q96PM1, Q96PT2, Q9HCI4
Gene ID:
dog(484975) zinc finger protein 317
domestic cat(101085102) zinc finger protein 317
Horse(100062199) zinc finger protein 317
domestic guinea pig(100720821) zinc finger protein 317
naked mole-rat(101717965) zinc finger protein 317
Domestic Rabbit(100351459) zinc finger protein 317
cow(506859) zinc finger protein 317
sheep(101108483) zinc finger protein 317
35 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020933 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020933 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020933 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086461 MISSION® esiRNA esiRNA human ZNF317 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020933 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200687 predicted 1647
2 SASI_Hs01_00200688 predicted 1770
3 SASI_Hs01_00200689 predicted 1567
4 SASI_Hs01_00200690 predicted 789
5 SASI_Hs01_00200691 predicted 1588
6 SASI_Hs01_00200692 predicted 1720
7 SASI_Hs01_00200693 predicted 1509
8 SASI_Hs01_00200694 predicted 863
9 SASI_Hs02_00354321 predicted 1087
10 SASI_Hs02_00354322 predicted 694
11 SASI_Hs01_00200695 predicted 928
12 SASI_Hs01_00200696 predicted 871
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020933
VALIDATED
ZNF317 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 317
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020933.2-1401s1c1
Sequence:CCGGCCGCTGGAAGTCCAACTTTAACTCGAGTTAAAGTTGGACTTCCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_020933.2-702s1c1
Sequence:CCGGGTCACTTCTTATGGAAGATATCTCGAGATATCTTCCATAAGAAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_020933.2-793s1c1
Sequence:CCGGGCTCACTTGTTCGAAGTCTTTCTCGAGAAAGACTTCGAACAAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020933.2-3529s1c1
Sequence:CCGGGCCTCCATCAAGTGGTAATATCTCGAGATATTACCACTTGATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020933.2-792s1c1
Sequence:CCGGCGCTCACTTGTTCGAAGTCTTCTCGAGAAGACTTCGAACAAGTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020933.3-691s21c1
Sequence:CCGGCACTTCTTATGGAAGATATTTCTCGAGAAATATCTTCCATAAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_020933.3-1387s21c1
Sequence:CCGGTCCGCTGGAAGTCCAACTTTACTCGAGTAAAGTTGGACTTCCAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020933.3-3438s21c1
Sequence:CCGGCTATGTGACATGAGGATATTTCTCGAGAAATATCCTCATGTCACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_020933.3-1715s21c1
Sequence:CCGGGAAAGTCTTCGGTGACTATTTCTCGAGAAATAGTCACCGAAGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_020933.3-1078s21c1
Sequence:CCGGACGCAAGAACTCACCTCAAAGCTCGAGCTTTGAGGTGAGTTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020933
VALIDATED
ZNF317 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 317
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020933.2-1401s1c1
Sequence:CCGGCCGCTGGAAGTCCAACTTTAACTCGAGTTAAAGTTGGACTTCCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_020933.2-702s1c1
Sequence:CCGGGTCACTTCTTATGGAAGATATCTCGAGATATCTTCCATAAGAAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_020933.2-793s1c1
Sequence:CCGGGCTCACTTGTTCGAAGTCTTTCTCGAGAAAGACTTCGAACAAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020933.2-3529s1c1
Sequence:CCGGGCCTCCATCAAGTGGTAATATCTCGAGATATTACCACTTGATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020933.2-792s1c1
Sequence:CCGGCGCTCACTTGTTCGAAGTCTTCTCGAGAAGACTTCGAACAAGTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020933.3-691s21c1
Sequence:CCGGCACTTCTTATGGAAGATATTTCTCGAGAAATATCTTCCATAAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_020933.3-1387s21c1
Sequence:CCGGTCCGCTGGAAGTCCAACTTTACTCGAGTAAAGTTGGACTTCCAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020933.3-3438s21c1
Sequence:CCGGCTATGTGACATGAGGATATTTCTCGAGAAATATCCTCATGTCACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_020933.3-1715s21c1
Sequence:CCGGGAAAGTCTTCGGTGACTATTTCTCGAGAAATAGTCACCGAAGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_020933.3-1078s21c1
Sequence:CCGGACGCAAGAACTCACCTCAAAGCTCGAGCTTTGAGGTGAGTTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020933
VALIDATED
ZNF317 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 317
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020933.2-1401s1c1
Sequence:CCGGCCGCTGGAAGTCCAACTTTAACTCGAGTTAAAGTTGGACTTCCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_020933.2-702s1c1
Sequence:CCGGGTCACTTCTTATGGAAGATATCTCGAGATATCTTCCATAAGAAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_020933.2-793s1c1
Sequence:CCGGGCTCACTTGTTCGAAGTCTTTCTCGAGAAAGACTTCGAACAAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020933.2-3529s1c1
Sequence:CCGGGCCTCCATCAAGTGGTAATATCTCGAGATATTACCACTTGATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020933.2-792s1c1
Sequence:CCGGCGCTCACTTGTTCGAAGTCTTCTCGAGAAGACTTCGAACAAGTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020933.3-691s21c1
Sequence:CCGGCACTTCTTATGGAAGATATTTCTCGAGAAATATCTTCCATAAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_020933.3-1387s21c1
Sequence:CCGGTCCGCTGGAAGTCCAACTTTACTCGAGTAAAGTTGGACTTCCAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020933.3-3438s21c1
Sequence:CCGGCTATGTGACATGAGGATATTTCTCGAGAAATATCCTCATGTCACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_020933.3-1715s21c1
Sequence:CCGGGAAAGTCTTCGGTGACTATTTCTCGAGAAATAGTCACCGAAGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_020933.3-1078s21c1
Sequence:CCGGACGCAAGAACTCACCTCAAAGCTCGAGCTTTGAGGTGAGTTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks